C. Mucic Acid Test for Galactose and Lactose describe the appearance of a few typical crystals under miscroscope
Q: Why do enzymes contain metals? What general reaction types to metalloenzymes catalyze?
A: Enzymes are biological catalysts proteinateous in nature that catalyze large number of biochemical…
Q: How do enzymes typically relate to the manipulated variables? our manipulated variables were…
A: Enzymes are high molecular-weight protein molecules that catalyse biochemical reactions. The…
Q: Adipocytes release uridine into the blood during fasting. Which hormone is found in the bloodstream…
A: Uridine is an important pyrimidine nucleotide required for RNA synthesis in living organisms. It is…
Q: 2. Draw the structure of the fatty acid, 16:247,10, as it occurs at pH 7. Make sure double bonds…
A: Fatty acids can be named and numbered in 2 ways. Fatty acids have a carboxylate end (COO- ) and a…
Q: Which enzyme in PPP creates glyceraldehyde 3 phosphate as a product? (Select all that apply)…
A: Pentose phosphate pathway (PPP) is an anabolic pathway that synthesizes pentose sugars and NADPH…
Q: Which electrolyte is most effected by hemolysis?
A: Hemolysis is the process of breakage of red blood cells. Hemolysis can be occurred due to viral and…
Q: Xylulose and ribulose are epimer pairs. Please explain why and how to identify epimer pairs
A: Epimers are the simple Sugars that differ in a single chiral centre or in the arrangement of OH…
Q: In active muscle cells, the pO2 is about 10 torr at the cell surface and 1 torr at the mitochondria…
A: Fractional saturation (Y) is the fraction of protein that is ligand bound. Y= moles of…
Q: Fatty acids and triglycerides are an important source of nutrition and a dense form of stored…
A: Carbohydrates are the primary source of energy. But in the absence of carbohydrates, the body…
Q: The inhibitor X prevents coenzyme Q (Q) from participating in electron transfer in the electron…
A: Electron transport chain is a chain of electron carriers present in the inner mitochondrial…
Q: create a concept map revolving around the topic nucleic acids. Use at least twelve (12)…
A: Nucleic acids are large biomolecules which plays important role in expression, storage and transfer…
Q: All enzymes of the citric acid cycle are located in the mitochondrial matrix, except succinate…
A: Cellular respiration is the process how biochemical energy is generated from food. It involves the…
Q: Examine the membrane lipid pictured below and answer the following questions: a. Is this lipid…
A: Fatty acids are carboxylic acids with a hydrocarbon chain. Fatty acids may be saturated or…
Q: 3. Pyrozole has been proposed as a possible nontoxic inhibitor of LADH-catalyzed ethanol oxidation.…
A: Since you have posted a question with multiple sub parts, we will provide the solution only to the…
Q: If the target protein is 0.1% of the total protein in the original mixture, a three-step…
A: Purification is a process by which impurities are removed from a sample and desired component is…
Q: “The binding of oxygen to hemoglobin exhibits positive cooperativity.” Explain briefly
A: Our red blood cells (RBCs) are composed of hemoglobin that helps to transport oxygen throughout the…
Q: Which of the following is the base component of the intracellular buffer? H₂CO3 HCO3 O H3PO4 O H₂PO4…
A: Buffers enable biological systems to maintain the pH within a particular range. Intracellular…
Q: What are some applications for metalloproteins?
A: Metalloproteins are the types of proteins or enzymes that binds to a metal ion as a cofactor in…
Q: Name the enzymes that catalyse (a) substrate-level phosphorylation and (b) coupled reactions during…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP the energy…
Q: Select one: O a. will require an input of energy O b. O c. will absorb energy O d. is not a…
A: The Gibbs–Helmholtz equation is a thermodynamic equation which is used calculating changes in the…
Q: 1) A ligand-binding protein showing negative homotropic cooperativity? a) should give an nH value…
A: Cooperativity or cooperative binding occurs when binding of one molecule influences the affinity of…
Q: Glycogenesis occurs in both muscle and liver. Select one: O True O False Glycogen is released from…
A: Glycogen is storage-type homopolysaccharide that contain two types of glucose polymers: amylose:…
Q: Question 6 In membranes, one of the most common targets of reactive oxygen species are saturated…
A: Fatty acids are carboxylic acids with a hydrocarbon chain. Saturated fatty acids are fatty acids…
Q: 4. Name this lipid. H₂C(CH₂) CH 0 CH₂-0-C-(CH₂)12CH3 0 CH(CH₂-C-0-CH COO™ CH₂-O-P-0-CH₂-CH 0 NH
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: Summarize the background information about the enzyme b-galactosidase ,protein purification in…
A: Enzymes are biological catalysts that increase the rate of a biochemical reaction. Enzymes do not…
Q: Structure, localization and biological significance of glycogen.
A: Introduction Cell needs energy for various metabolic processes. Glucose breaks into pyruvate and…
Q: ОН ОН ОН tautomerization
A: Tautomerization is the process by which structural isomers interconvert between each other. The…
Q: Name the primary sources of ATP for: a. Immediate energy for a few seconds b. Energy extending to…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP: the energy…
Q: 15-24 b) c) Identify the molecules oxidized and reduced in the following reactions: a) CH₂CH₂CHO +…
A: Many redox reactions occur during metabolism. Redox reactions necessitate the transfer or removal of…
Q: Describe the structural similarities and differences of the following pairs. Identify which of these…
A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified as monosaccharides,…
Q: Which monosaccharide(s) seen below is(are) an epimer of the structure on the left? H- НО Н- H CHO О…
A: Two isomers that are correlated to one another by reflection are called optical isomers or…
Q: Which of the designations are accurate for the fatty acid?
A: Simple fats or triglycerides are fatty acid esters of glycerol, where three fatty acid molecules are…
Q: The structure of a metalloenzyme active site is down below(black picture). Describe, from a chemical…
A: Methane monooxygenase (MMO) is present in methanotrophic bacteria and MMO is present in an integral…
Q: How do Lipids vary from other macromolecules?
A: A living cell is the basic unit of life. It is capable of independent existence (as is the case of…
Q: The Na,K-ATPase is a(n) [Select] [Select] and K+ from [Select] that moves Na+ from
A: When 2 species are transported in the same direction by a transporter, this type of transport is…
Q: Mechanism of action of electron transport inhibitors. Antimycin A.
A: ETC consist of four protein complexes called Complex I, II, III and IV that transport electron…
Q: Using Haworth projections, draw the structure of an a-disaccharide of mannose B(1,2) galactose…
A: Carbohydrates or carbs are macronutrient consisting of Carbon, hydrogen and oxygen atoms. In nature…
Q: Yield of ATP in complete oxidation of stearic acid including payback of transport costs using…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons.…
Q: High levels of glucose-6-phosphate inhibit glycolysis. If the concentration of glucose-6-phosphate…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP the energy…
Q: Identify two (2) functions of lipids in the body. Explain each function in 2 sentences.
A: Lipids are a very important class of biological molecule. Lipids are a broader class of molecule…
Q: Uncouplers of oxidative phosphorylation are all expect: Select one: O a. thermogenin O b.…
A: INTRODUCTION: (Oxidative phosphorylation) The process by which ATP is formed as a result of the…
Q: 3. Attach the structures below to draw a sphingolipid. CH3-(CH2) 12-CH=CH-CH-OH sphingosine CHINH,…
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: Discuss three of the major steroids derived from cholesterol and their physiological role.
A: Lipids are a chemically diverse group with two common characteristics: low solubility in water and…
Q: 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above…
A: The DNA contain genes (functional unit) that encode protein molecules. Proteins are the "workhorses"…
Q: 60. During a study of thyroid hormone function, an experimental line of mice is genetically…
A: the thyroid gland malfunctions and doesn't produce enough thyroid hormones: thyroxine and…
Q: Draw the electron pushing mechanism
A: Electron pushing mechanism shows the jumping of electrons in the substrate and reaction…
Q: A cyclic AMP (CAMP) binding protein was isolated from mammalian cells and characterized by…
A: Given that,The ligand is cAMPThe receptor is cAMP binding protein (CBP)also the concentration of CBP…
Q: One of your colleagues has obtained a sample of muscle phosphorylase b that is known to be…
A: Glycogen is storage-type homopolysaccharides that contain two types of glucose polymers: amylose:…
Q: b-oxidation occurs ONLY under aerobic conditions. Why? Glycolysis occurs under anaerobic conditions,…
A: Beta-oxidation of fatty acids is the process by which long chain fatty acid molecules are broken…
Q: Consider the fatty acid. Which of the designations are accurate for the fatty acid?…
A: There are four types of biological macromolecules: nucleic acids, lipids, proteins and…
C. Mucic Acid Test for Galactose and Lactose
describe the appearance of a few typical crystals under miscroscope
Step by step
Solved in 2 steps
- C. Mucic Acid Test for Galactose and Lactose Galactose, on being oxidized with HNO3 forms mucic acid, an isomer of saccharic acid. Mucic is insoluble andforms characteristic sandy crystals which serve to identify galactose. Examine the crystals under the microscope. Describe the appearance of a few typical crystals.C. The following successive dilutions are applied to a stock solution that is 5.60 M sucrose: Solution A = 46.0 mL of the stock solution is diluted to 116 mL %3D Solution B = 58.0 mL of Solution A is diluted to 248 mL Solution C = 87.0 mL of Solution B is diluted to 287 mL 1. What is the concentration of sucrose in solution B? 2. What is the concentration of sucrose in solution C? 3. What is the dilution factor of Solution A? 4. What is the dilution factor of Solution B? 5. What is the dilution factor of Solution C?Discuss the color changes that occurred in EDTA titration. Show the formula if necessary.
- Name: Report Sheet: Proteins (page 4) Would the Ninhydrin test be reliable in determining the presence of proteins? Explain. Will any amino acid having an aromatic ring give positive Xanthoproteic test result under identical conditions? Why? Do most proteins give a positive Xanthoproteic test? Why or why not? For what chemical group is Millon's reagent a test? Write the formula and the name of the amino acid for which this reaction is a test. What chemical grouping is responsible for a positive Hopkin's-Cole Test? What element in the amino acid is detected to be present in the lead acetate test? 31 | Biochemistrya. Why is iodine tincture a good indicator to use for testing the presence of unsaturated fats? b. Based on the degree of saturation, which lipid is a better choice to spread on food, butter or margarine?Describe the evidence of Picric acid test to show a positive result for the presence of a specific sugar in a material or substance.
- . Discuss the properties of potassium iodide solution, and how it results in the detection of starch. . Explain the meaning of each color that results in Starch Test, such as: 11.1 Yellow to brown and; 11.2 Blue to black.C. Choosing the Proper Buffer Solution 1. Choosing the Proper Buffer Solution In Protein Precipitation, two liters of 5mM buffer solution with pH 5.2 is needed in the isolation of albumin. Which among the following buffer solution is best fitted for said purpose? Justify your answer. Buffer solutions pKa Acetate buffer 4.73 Tris- (hydroxymethy) aminomethane 8.08 Phosphate buffer 7.20 Discussion: 2. Preparation of the Chosen Buffer System Calculate and measure the amounts (in grams if solid and in mL if liquid) of weak acid and conjugate base needed to be able to prepare the chosen buffer system in part A above. Express your answer in useful units (that is, prepare it from practical amounts or concentrations of starting materials). D. Titration of an Amino acid Graph: titration of Glutamic acid Glu Glu Glu" Glu- COOH Co0 co0 Co0 H,N*-C -H H,N-C-H H,N*-c-H H,N -C -H CH2 CH2 CH, CH2 CH CH, CH, CH2 COOH соон co0 Co0 14 12 10 pK pH pkg Isoelectric point pk, 1.0 2.0 3.0 Equivalents of COH"…Based on this video https://www.youtube.com/watch?v=rKng5-ij6kQ Provide a schematic diagram for the Molish ’s test methodologies in determining the presence of carbohydrates. Also, give the basic principle for the test.
- After how minutes the color is obtained with each carbohydrate in Resorcinol test?a. State the importance of using following reagents in SDS-PAGE. 1. Acrylamide 2. Bisacrylamide 3. Tetramethylethylelediamine 4. Glycerol 5. Ammonium persulfate b. Briefly describe the importance of two dimensional electrophoresis in protein separation?Group of lipids identified in Acrolein Test