Q: What is the main idea of pseudoreplication in a manipulative experiment? Give an example problem of ...
A: Pseudoreplication is described as using inferential statistics to check for treatment effects with s...
Q: Spondylocostal dysostosis is an autosomal recessive disorder with characteristics including short th...
A: Introduction : Hardy Weinberg principle states that the allele frequencies in a population are stabl...
Q: The following table provides results (petal colour) of 4 different F1 X F1 crosses. The genes involv...
A: Mendel uncovered the fundamental laws of heredity. His experiments demonstrated that the inheritance...
Q: Explain a powerful methodology for studying gene expression ?
A: The functions of a gene can be studied by looking at how it expresses in a specific cell and how it ...
Q: Create a crop plan for three seasons of Bio-Intensive Gardening using the following crops: camote, r...
A: Biointensive agriculture:- it is an organic agricultural system. It focuses on achieving maximum yie...
Q: Let’s say that a large ancestral population of really cool organisms is subdivided, by a geological ...
A: Given, p is the frequency of allele A= 0.75 Your answer attached below
Q: How to determine the location of restriction sites for different enzyme ?
A: Enzymes are proteins that are present in the body and help to speed up metabolism or other chemical ...
Q: Do a punnet square to find the possible genotypes and phenotypes of the F1 generation when a plant t...
A: Parents - (a) homozygous for recessive pod color and heterozygous for pea shape - ggRr (b) heterozyg...
Q: Explain how the allocation of carbon to plant roots influences net carbon gain by plants.
A: We are allowed to do only one or upto three subpart of a question. Please repost the undone question...
Q: Climate is the result of a variety of global processes. What of the following is a climatological dr...
A: Global warming is the long-term heating of Earth's climate system observed since the pre-industrial ...
Q: Answer 19,20,21,22 whether true or fale for each number 19.Wear dust-mask or cover your face with c...
A: The goal of island biogeography is to study the climatic conditions which affect the flora and fauna...
Q: 1.Meiosis results in how many more daughter cells than mitosis? 2. Which type of cell division invol...
A: Cell division is basically a metabolic process takes place inside the cell in which parent cell unde...
Q: In a patient with C7 lesion with Brown Sequard Syndrome, the tracts affected are Dorsal Column Tract...
A: Brown Sequard Syndrome is caused by damage to the ascending and descending spinal cord tracts on 1 s...
Q: 1. An ebony strain of flies was discovered to be sensitive to carbon dioxide. Crossing a female sens...
A: A reciprocal cross is a breeding experiment used in genetics to determine the impact of parental sex...
Q: In which specific area in the leaf does the dark reaction occur? In what area do the light reactions...
A: Light reaction is the process of photosynthesis in which the sunlight energy is converted to ATP and...
Q: In the absence of centrioles among the cells of higher plants, give one pole-based mechanism exhibit...
A: The "cell cycle", also known as "cell division", is a set of processes that occur in a cell leading ...
Q: Suppose that a cow is launched into space, far from the Sun, wearing a suit that provides it with ox...
A: Hypothermia is a dangerous and substantial reduction in body temperature. Prolonged exposure to cold...
Q: Examples of medical/scientific ethical issue
A: Whenever a judgment, situation, or activity conflicts with a society's moral standards, ethical dile...
Q: Effects of BPA on phosphorylation
A:
Q: Which of these results in the acquisition of a characteristic that promotes adaptability? Natural s...
A: Adaptation is a transformation in an organism's structural and functional traits that happens as a r...
Q: A zoologist is studying a deer and found out that a gene is located on autosome two. This gene contr...
A: The genes are located on the particular locus of the chromosome. An organism contain autosomes and s...
Q: If curly hair is genetic, why do you have curly hair if none of your ancestors did?
A: The answer to your issue may lay in the manner in which hair-type genes are passed down across famil...
Q: Why is it that every cell needs to contain the DNA for the entire body when only a few of its genes ...
A: Every cell contains the DNA for the entire body but a few are expressed by its cell type. The reason...
Q: Effects of BPA on phosphorylation and translocation of NFκB and degradation of IκB in RAW264.7 cells...
A:
Q: Use the following sense DNA sequence 5'- ATGTCCTGGTAA-3' to answer the following questions below. Fo...
A: A) The resulting polypeptide from the mutated DNA sequence is- 5'-ATGTCCTGGTAA-3' Sense DNA sequenc...
Q: Effects of BPA on phosphorylation of JAK family in RAW264.7 cells
A:
Q: n is forever. Do you agree or di
A:
Q: What is the advantage of a lower LCP for plant species adapted to low-light environments? What is th...
A: Introduction LCP:- Light Compensation point The LCP is the PPFD value at which the rate of photosynt...
Q: 1. If two genes, A and B, are completely independent, a testcross with an individual heterozygous at...
A: 1. A dihybrid cross between individuals heterozygous for both traits will result in a 9:3:3:1 phenot...
Q: The glaciers act as water reservoirs that supply many of the Earth’s large rivers. When glaciers ret...
A: Glaciers are an important source of fresh water and many rivers such as Ganges Indus They are f...
Q: 1. You have been charged with breeding larger Leprechauns for next St. Patrick's Day. You measure th...
A: Selection differential is the difference in the base population mean and the mean of the selected pa...
Q: What is Hybridization/Annealing ?
A: Annealing which is also known as Hybridization is defined as the spontaneous pairing occur of comple...
Q: In logistic growth, large values of r (e.g., >3) can cause the population size to stay greater than...
A: Intrinsic rate Intrinsic rate the the net growth rate of a population. It can be calculated as numb...
Q: With your tests you now figured out that your patient has a Staphylococcus infection, and you would ...
A: S. epidermidis and S. aureus come under the category of bacteria and are associated with nosocomial ...
Q: Differentiate the patterns of biodiversity? (Spatial pattern of biodiversity and Temporal pattern of...
A: Answer Spatial and temporal pattern of biodiversity :
Q: Effects of BPA on NO/iNOS and PGE2/COX2 expression in RAW264.7 cells
A: BPA Bisphenol A is an harmful endocrine disruptor found in plastics. Many chemicals in the environm...
Q: Mutations in the genes of an operon could affect the expression of its genes. For each statement, in...
A: Introduction: Mutation can be defined as any change in DNA. This is any heritable and genetic change...
Q: Disease occurred-How did the population growth curve with many predators compare the normal populati...
A: An ecosystem is a natural community of living beings that deals with the external environment and ot...
Q: You have isolated a true-breeding fish strain that has blue scales. Then you isolate another true- b...
A: Recessive epistasis - Recessive epistasis happens is when the recessive allele, or variation of a ge...
Q: complex process, you decide to draw for the class a typical eukaryotic gene/transcription unit with ...
A: PPE stands for a promoter-proximal element which is an additional promoter that contains AT-rich bas...
Q: What crop characteristics influence yield? Size of source (manufacture) and sink (storage and/or usa...
A: The most important factors affecting crop yield include:- Soil Fertility:- Tbe main criteria for gr...
Q: In your own understanding, explain the storage and mobilization of lipids.
A: A lipid is a macro biomolecule which is soluble in non - polar solvents in biology and biochemistry....
Q: What are the roles of ATP and NADPH in photosynthesis? a. ATP and NADPH are forms of chemical e...
A: On the Earth , the only source of energy is the Sun. Sun is the only source that provides energy to ...
Q: Compare CRISPR-based endonucleases with restriction endonucleases.
A: Introduction CRISPR and restriction enzymes are two types of gene modifying methods.
Q: Discussions on crime and deviance suggest that biological explanations of crime are superior to all ...
A: Eugenic movement deals with the genetic construction of an individual. With the theory of Cesare L...
Q: Cell motility has been described as being like the motion of tank treads. At the leading edge, actin...
A: Protrusion of the leading edge of the cell, adhesion of the leading edge and deadhesion at the cell ...
Q: What is the relationship of Natural Selection and Speciation? Answer in no less than 10 sentences
A: Natural selection is a process in which an individual with enhanced reproductive fitness is selected...
Q: Use this diagram of nett square to answer the following questions. Which part of this diagram repres...
A: Punnett square It is diagram that is helpful in predicting the genotypes of a specific cross in a br...
Q: The CDC estimates 20 million new cases of sexually transmitted infections (STIS) in the United State...
A: Sexually Transmitted Infection (STI) is an infection transmitted through sexual contact, caused by b...
Q: how do you distinguish nuclear from extrachromosomal inheritance? Give a specific example.
A:
Which one are true or false
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- The sequence below is a template strand sequence for a gene (a very short one!). Identify the start codon and the amino acid sequence of this gene. Write your answer in 3 letter amino acid code. Put a hyphen between each amino acid. You should also include a description of any working or steps you have taken to determine your answer. 5' AGTCAGCAAGAAGACATCAGTGTTCCCATCTGT 3' Paragraph V B I U A = 8⁰ + v 11.015347/quizzes/5825797/take 21. The processing events that must occur on the MRNA after it is transcribed, but before it is released into the nucleus include (select all that apply) Primary RNA transcript Exon 1 Intron Exon 2 Intron Exon 3 RNA processing Spliced RNA Exon 1 Exon 2 Exon 3 AAAAAAA 5' cap Poly-A tail 3' untranslated region 5' untranslated region O folding into its functional shape O splicing out exons O adding a poly-A tail O removal of non-coding sections O capping the 5' end hpebitgeqyloq erl to noihoq ertt qu 9lem bluow iert ebios onime et enimalsb nworle llew as yes TOi noitemoini ebulonl elelgmst AMO 3. The following MRNA strand is being used to assemble a polypeptide strand by a ribosome: 5'-AUGCUUGCUCAUCGGGGUUUUAA-3' AHR (a) Write out the amino acids that will be assembled, in their correct order. (b) Provide an alternative MRNA sequence with four or more changes that would translate to the same amino acid sequence.
- 16S sequence information will be composed of: As and Us and Cs and Gs that make the mRNA sequence dn As and Ts and Cs and Gs that make up the DNA sequence amino acids that build the ribosome amino acid codons that make up the mRNA small enzymes that build the ribosome(ol soupe bannos96 SAM 3 A small strand of DNA has this sequence: 0pxbeter owl nade hoparg TACCGGAAACTG ATGGCCTTTGAC a. If the TOP strand is the template strand, what will be the mRNA made from this DNA read from left to right? What process allows for the mRNA to be made? b. If this is a eukaryotic mRNA, where does transcription occur? What would happen if the mRNA was not processed? c. What is the sequence of the protein made (use the genetic code below)? What process allows for the protein to be made?es/2015347/quizzes/5825805/take The "factory" itself, made of two [Choose] subunits [Choose ] FRNA The site from which the growing polypeptide chain exits the ribosome RELEASE FACTOR CODON RIBOSOME P SITE The processed copy of DNA that UGA carries its sequence of codons to the TRNA ribosome AUG ANTICODON MRNA The carriers of each unique amino acid E-SITE to A-site of the ribosome The three letter message carried to [ Choose ] the ribosome on the "toes" of the TRNA The site from which the now empty [ Choose ] TRNA leaves the ribosome The first codon required to initiate [ Choose ] translation (on the mRNA). The binding chemical that comes along once the STOP codon is encountered: disassembles the ribosomal complex [Choosc] hp
- Kindly help, I don't understand this topic :(( In each of the following DNA sequences, write the contesponding mRNA transcript right beside the item we the item and use the genetic code to determine the resulting amino acid sequence. You may proceed even without the start codon 1. TTTTACCATCCCACAATTTA 2 ACTACTTTCAGAGCTATATTCAG 3. CATTACGGAGCCTGATGCACTTAC 4. TACGCCGCAACTCCGTATGGO 5. Garg-CTACAGCCCTAGCATTTACCCGIf DNA segments changes from GCATAG to GCATA, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base U A G 0001 Phenylalanine UCU UAU1 Tyrosine (Tyr) UAC UGUT FCcysteine (Cys) UGCJ U UUCJ (Phe) UCC Serine (Ser) UCA U UUA1 UAAT UGA - Stop A FLeucine (Leu) UUG- FStop UAG- UCG- UGG - Tryptophan (Trp) G CU- CCU CGUT CAU1 Histidine (His) CAC U CUC FLeucine (Leu) CUA CC Proline (Pro) CCA CGC FArginine (Arg) CGA CAA1 Glutamine A CAGI (Glu) CGG- CUG- CCG- G AUU AAU1 Asparagine ACU1 AGUT FSerine (Ser) AGC- AUC FIsoleucine (le) ACC Threonir AACJ (Asn) A AUA- ACA (Thr) AAA1 FLysine (Lys) AAG- AGA, FArginine (Arg) AGG- A Start Methionine (Met) ACG- AUG - GUU- GCU GAU- GGU | Aspartic Acid GAÇJ(Asp) U GỤC Valine (Val) GUA GCC FAlanine (Ala) GGC Glycine (Gly) GGA G GAA1 Glutamic Acid A GCA GCG- GAGJ (Glu) GGG- GUG- GWhich codons do not have a matching tRNA? Select all that apply O UAA O AUG O UGA UGG OUAG
- DNA MANNMANN B) mRNA Transcription Transport to cytoplasm for protein synthesis (translation) Mature mRNA b mRNA Cell membrane You are trying to explain to your classmate how DNA is used to make proteins. What should you include explanation? Select ALL that apply. During translation, the genetic code in mRNA is read and used to put amino acids in place to make a protein. During transcription, the genetic code in mRNA is read and used to put nucleotides in place to make a protein.(2/וt/ MODULE 11B- Transcription and Translation handouts Transcription and Translation Practice Worksheet nie For cach of the following sequences, fill in either the DNA, the mRNA sequence, the tRNA anticodons, or the amino acid scquences that have been left blank. If several sequences might work choose any one. ang IAC TGA TCG ACC ccc ATA ATG AAA ATC 1. DNA AUG ACU AGC UGG GGG UAU UAC UUU UAG MRNA unc uGA ucG ACc ccc AuA AUG AMA AUC (RNA AA 2. DNA TAC CGC ТСС GCC GTC GAC АСС AAT АСТ AuG GcG AGG CGG CAG cU uuA UGGUGA mRNA UAG CGc UCc Grs Guc GAC AAU ACC ACu tRNA AA TAC CGTGGG TTT TTC ATG GTT GGG TAA AuG GuG 3. DNA GGG GCA UAC CGA CCC uUA UAG mRNA tRNA UAC CAC ССС CGU AUG A AU GCU GGG AUC AA 4. DNA ATG CGI GGG TTI TTC ATG GTAGEG UAC GCA CCC AAA AAG UAC CAA mRNA AuG CGu GGG Wlir lur AuGGuu GGGUAA tRNA AA MET ARG GLY PHE PHE МЕТ VAL GLY (STOP) 5. DNA TAC CTCACA CTAGCT ATG 7G cc mRNA UGU GAU tRNA CU C UUG AUU Itr VAL LEU MET AA TFR ALA PROA small section of MRNA codons has the following sequence: UGU GGU CAA CCG Some Amino Acids 1. Valine 2. Serine 3. Proline 4. Glycine 5. Arginine 6. Leucine 7. Histidine 8. Cysteine 9. Glutamine The amino acids listed above that are coded by the MRNA codons are , and Record your answer in order from left to right codons.