Your colleague wants to align the complete sequence of the collagen gene from humans to the homologous complete gene in rats. She can't decide if she should use the alignment program Needle or Water, and turns to you for help. Does it make a difference which program she uses, what advice would you give her?
Q: Explain how you would prepare serial dilations of 10-2,10-4,10-5 of a milk sample in three steps
A: Serial dilution is a lab procedure used in microbiology to estimate the concentration or number of…
Q: 3. Discuss the different types of chemical and physical preservation of blood, stool and sputum…
A: Introduction :- A parasite is a creature that lives on or in its host and feeds on or at the expense…
Q: Adapoids and Omomyoids divided food type resources as a way to avoid competion, driving species…
A: Introduction Omomyoids (also spelled omomyiforms or omomyids by some) are members of the superfamily…
Q: Which of the following impact the carrying capacity of an area? Size of area How fun it is Food…
A: Carrying capacity Every environment has organisms surviving in it. all organism relies on two basic…
Q: 1. On a hot day a tourist in the wilderness could not find a source of drinking water for a long…
A: a. Vasopressin and aldosterone main hormone which regulates the water and minerals balance.
Q: 1. What structures are these DNA strand likely to adopt in solution (assuming sufficient salt…
A: A-DNA is one of the possible double helical structures which DNA can adopt. A-DNA is thought to be…
Q: Discuss the role of the nervous system intemperate regulation
A: Introduction :- Your nervous system is the control centre of your body. It originates in your brain…
Q: Draw and Label Lymph vessels and nodes of Head and Neck
A: Introduction Lymph is the fluid that flows through the lymphatic system, which is made up of lymph…
Q: Identify whether the statements are TRUE or FALSE 1. You should use P-20 micropipettes to transfer…
A: p20 micropipette The p20 micropipette is usually used to measure amounts between 1.0 µL and 20 µL.…
Q: Explain how cloning mammals provides evidence for genetic equivalence
A: Cloning: The technique of generating a genetically identical copy of a cell, tissue or an organism.…
Q: How is cardiopulmonary resuscitation administered?
A: Cardiovascular complications The cardiovascular system consists of the major organ, the heart, that…
Q: For many years it was a complete mystery howcytotoxic T cells could see a viral protein that seemed…
A: T and B cells are immune system lymphocytes that aid in the elicitation of an immune response…
Q: it true that social insects have a greater ability to change the environment than solitary insects?
A: INSECTS Insects belong to the class Insecta and phylum Arthropoda which consist of the largest…
Q: In plant physiology, What is leaf abscission and how is it controlled by the interaction between…
A: Fall leaf abscission is believed to be made by a decrease of chlorophyll due to shortened long…
Q: To describe: The three ways in which natural selection can affect a population over time.
A: Natural selection is the process through which heritable features that increase the likelihood of…
Q: How do respiratory adaptations enhance the limits of diffusion?
A: The specific changes which the respiratory system goes through in due to the strain of physical…
Q: Monohybrid Crosses and Punnett Squares Punnett squares are diagrams that can be used to predict the…
A: Individuals inherit two alleles of the same gene from each of their parents. The alleles could be…
Q: Research and define the following: A. Nuclear medicine B. Chemotherapy
A: Introduction:- Medicines can be used to cure illnesses and improve the overall health. Most…
Q: If both mutation and drift are acting simultaneously, predict how this will influence variation in…
A: If both mutation and drift are acting simultaneously, predict how this will influence variation in…
Q: The discovery of Australopithecus afarensis (Lucy) was anatomically important because of what trait?…
A: Introduction The process of natural selection is used to change the characteristics of a species…
Q: Help me on my reviewerrr
A: Skin is the largest organ in the body. Skin also acts a first line of defense in our immune…
Q: What explains how the parents in a family both have the same eye color, but some of their children…
A: Parents have same eye colour. Suppose eye colour determine by the Allele a A is dominant over a.
Q: what are the objectives of helping stray animals in the community as well as its beneficiaries
A: Introduction A stray animal is defined as any animal that is lost, abandoned, unclaimed, or…
Q: Morphogens play a key role in development, cre-ating concentration gradients that inform cells of…
A: Introduction Life starts from a single cell called Zygote. A zygote is formed by the fusion of the…
Q: Provide three specific lines of evidence supporting (or refuting) the hypothesis that humans and…
A: Horseshoe crab evolved in the shallow seas of the Paleozoic Era (540-248 million years ago) with…
Q: 1. Which component of the Philippine Health Care Delivery System is characterized by health…
A: Note: As Per Guidelines, We Can Answer One Question At A Time. Ask Again To get rest answers.…
Q: Kindly LIST the integumentary organs of the following representative chordates. Please answer direct…
A: Introduction The integumentary organs includes skin, hair, nails and glands. It forms the outermost…
Q: 8) In Saccharomyces cerevisiae (yeast), what is the term for the production of asexual cells? a)…
A: Saccharomyces cerevisiae It is a species of yeast also called brewer's yeast or baker's yeast as it…
Q: 8. Which of the following would increase resistance? shortening the wire Omaking the wire thinner…
A: Answer : the statement which would increase the resistance is : b. Making the wire thinner.…
Q: A person cannot see a single cotton thread 100 feet away, but if you wound thousands of threads…
A: DNA extraction and polymerase chain reaction are two basic molecular laboratory methods (PCR). This…
Q: The plasma membrane side facing the extracellular fluid is negatively charged True False
A: Plasma membrane structure consists of a continuous bilayer of phospholipid molecules in which…
Q: In mice, the Y locus controls coat color, and the Y allele (yellow) is dominant to y (non-yellow).…
A: In multicellular and other eukaryotic organisms, the genetic makeup of the organism consists of 2…
Q: etion enzyme Sall cuts the sequence GTCGAC to leave a five base, 5' overhang. The restriction enzyme…
A: A restriction enzyme is classified under the category of a protein. These are isolated from bacteria…
Q: How does asynchronous flight muscle differ from that of synchronous? Which is capable of faster…
A: Flight is carried out by muscles that are attached directly to the muscles called direct flight…
Q: Write a brief explanation of how, by calculating forces and torques in a physical system such as the…
A: Lifting Mechanicss During lifting of an heavy object spine has to support both the weight of the…
Q: 4. a a a a Complete each of the following Punnett squares A a A a A A a A A A A a
A: Note: Since you have asked multiple questions, we will solve the first question for you. If you want…
Q: Which if the following is true about the cleavage of Tunicates? Choose all possible answers…
A: Tunicates Tunicates are the invertebrate chordates, These are also known as Ascidians, these are…
Q: Which of the following statements describing the mobilization and utilization of fatty acids in the…
A: Introduction Fatty acid oxidation is the aerobic mitochondrial process of breaking down a fatty acid…
Q: What activity is the main cause of smog? O release of ozone by factories pesticide use on farms…
A:
Q: 76. (a) The risk of acquiring COVID-19 infection is greater when you eat at home rather than when…
A: NOTE: Since you have posted multiple questions so we will be solving the first three for you. As per…
Q: Describe three (3) environmental management principles and explain how you, as a student and young…
A: Introduction There are 7 basic environmental management principles:- Polluter Pays Principle (PPP)…
Q: Suppose a species of tulip has three alleles for the gene that codes for flower color. The CR allele…
A: A trait is a characteristic features that is unique to particular individual . In tulip , there are…
Q: 1. The Fehling’s reaction, which is a simple assay for reducing sugars, was used as a diagnostic…
A: as per our guidelines we are supposed to answer only one question when multiple questions are asked.
Q: . What are the major differences between errant and sedentary polychaetes? What are the important…
A: We are answering only the first question. Please repost the remaining questions separately.…
Q: 1. What are the major steps in urine formation in a nephron? 2. Describe the important processes…
A: Introduction :- The structure that really makes urine in the process of eliminating waste and excess…
Q: 27. Which of the following is/are direct effect/s of heat exposure in an industry? 1. Heat…
A: Exposure to extreme heat can cause severe injuries and illness. This causes confusion, high body…
Q: Why 3' end should be G and C and 3' should not have more than 3 consecutive G and C?
A: Polymerase Chain Reaction ( PCR) is a technique of making numerous copies of genetic material ( DNA…
Q: Describe what you might see, smell, and hear hiking through a deciduous forest
A: Introduction Deciduous forest, a type of vegetation made up primarily of broad-leaved trees that…
Q: Provide the modes of reproduction present in plants and animals
A: Depending on the number of parents involved, there are different modes of reproduction. Every living…
Q: Below is a generalized figure of replicating DNA. Describe what is occurring for each figure.
A: DNA replication is the process of new DNA synthesis from the old DNA molecule that occurs within the…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- you join a laboratory that studies a rare genetic disorder that causes affected individuals to have unusually fast growing bright green hair you are joining the lab at a fortuitous moment as the gene causing the isorder has jut been cloned despite this brakthrogh however it is still unclear that the function of th gene is and the lab director asks you for suggestions about how to go about trying to determine this what would you recommendi have a gene (3222bp) i want to put it into a expression vector (pet 28b+),when i did pcr i flanked my insert with EcoRI and HindIII restriction sites,how do i ensure that i insert the gene in the correct orientation in the vector,so that translation of the gene into a protein occurs.if the gene is inserted in the wrong direction would that mean i cant translate or would it just give me the wrong protein produced. also is the vector the one providing the start and stop codon ,and if so how do insert my gene so that it has a start and stop condon in the right framThe DNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the mRNA molecule that is generated from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' For the toolbar, press ALT+F10 (PC) or ALT+FN+F10 (Mac). B I UIS Paragraph Arial 10pt A v T 0 $1
- I recently isolated the human enzyme called fucosidase and prepared anantibody to it. Now I want to isolate a cDNA clone coding for this enzyme from a human cDNAlibrary. A friend of mine in the lab next door has informed me that he had recently isolated acDNA coding for dog fucosidase that I can use if I desire. In addition, I just read an article whichreported the sequence of the first 20 amino acids of human fucosidase. Which of the probeslisted below do you think I could use to screen my library to identify the cDNA clone containinghuman fucosidase?You are asked to sequence a piece of DNA to determine if it is from a gene thought to be involved in the development of breast cancer. The sequence of the template strand is ATGCCCGTAATCGTTA and you are given the primer TAACGA. You take these along with a sequencing kit that contains everything else needed for sequencing. You then run the sequencing experiment and analyze the results on a sequencing gel. Which of the following gels (A-D) is the correct sequencing gel for this experiment? Answers: A-D A A BB CC DD Question #3 attachment A ATOC B с A TO C ATOC ATOCThe length of a particular gene in human DNA, measured from the start site for transcription to the end of the protein-coding region, is 10,000 nucleotides, whereas the length of the MRNA produced from this gene is 4000 nucleotides. What is the most likely reason for this difference? Explain in detail. For the toolbar, press ALT+F10 (PC) or ALT+FN+F10 (Mac). A Ix BIUS Paragraph Arial 14px
- The human RefSeq of the entire first exon of a geneinvolved in Brugada syndrome (a cardiac disordercharacterized by an abnormal electrocardiogram andan increased risk of sudden heart failure) is:5′ CAACGCTTAGGATGTGCGGAGCCT 3′The genomic DNA of four people (1–4), three ofwhom have the disorder, was subjected to singlemolecule sequencing. The following sequences represent all those obtained from each person. Nucleotidesdifferent from the RefSeq are underlined. Individual 1:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGCGGAGACT 3′Individual 2:5′ CAACGCTTAGGATGTGAGGAGCCT 3′Individual 3:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGGCGGAGCCT 3′Individual 4:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGTGGAGCCT 3′a. The first exon of the RefSeq copy of this gene includes the start codon. Write as much of the aminoacid sequence of the encoded protein as possible,indicating the N-to-C polarity.b. Are any of these individuals homozygotes? If so,which person and what allele?c. Is…You just graduated from college and started working at a biotech startup called Scrofabulous. Your first job assignment is to clone the pig gene for the hormone prolactin. Assume that the pig gene for prolactin has not yet been isolated, sequenced, or mapped; What would be the most useful and economical first step to go about identifying and cloning the pig gene for prolactin? use the amino acid sequence of mouse prolactin to design a pair of degenerate oligonucleotide PCR primers to PCR-amplify the pig prolactin gene. RNAseq the pituitary gland of the pig, the most abundant gene is likely to to be prolactin Conduct a proteome search for peptides that match parts of mouse prolactin protein Sequence the pig genome, then translate the genome to find the gene predicted to encode for prolactin Crystalize the mouse prolactin protein and use Google's DeepMind Al to find the closest amino acid sequence in the pig proteome2) The partial coding sequence of the Spike protein for SARS- COV-2 is shown below: You are tasked with designing 2 primers to clone this gene by PCR amplification. What are the sequences of the two 21bp primers in the 5' to 3' orientation that will allow you successfully amplify this gene? АTGTTTGTTTTТСTTGTTTTATTGCCACTAGTCTСТAGTCAGTGTGTTAATCTTACAАССAGAACTCAАТТАСССССТGСАТАСАСТААТСTTTCАCАC GACCAGTTGCTGTAGTTGTCTCAAGGGCTGTTGTTCTTGTGGATCCTGCTGCAAATTTGATGAAGACGACTCTGAGCCAGTGCTCAAAGGAGTCAAA O A) ATGTTTGTTTTTCTTGTTTTA and GTCAAATTACATTACACATAA O B) TAAAACAAGAAAAACAAACAT and TTATGTGTAATGTAATTTGAC O C) ATGTTACTTGGTGACCAGTTG and GTCAAATTACATTACACATAA O D) ATGTTTGTTTTTCTTGTTTTA and TTATGTGTAATGTAATTTGAC
- Whole-exome sequencing (WES) is helping physicians diagnosea genetic condition that has defied diagnosis by traditionalmeans. The implication here is that exons in the nucleargenome are sequenced in the hopes that, by comparison withthe genomes of nonaffected individuals, a diagnosis might berevealed. What are the strengths and weaknesses of this approach?Based on the following wild type DNA sequence, indicate if each of the mutations should be classified as : insertion, deletion, missense, nonsense, silent (Use the provided Genetic Code table and remember you have been given DNA sequence). Wild Type: AUGAUUCUUAAAAGU Mutant 1: AUGAUUCUUUAAAGU Mutant 2: AUGAUUCUUGAAAGU Mutant 3: AUGAUCCUUAAAAGU Mutant 4: AUGAUCCUAAAAGU Mutant 5: AUGAUCCUUAAACAGU Socond letter Key: Ala = Alanine (A) Arg Arginine (R) Asn = UUU } UAU Tyr UGU UGC Cys UGA STOP UGG Trp UCU UCC UUC Phe Ser Asparagine (N) Asp = Aspartate (D) Cys Cysteine (C) Gin = Glutamine (Q) Glu = Glutamate (E) Gly = Glycine (G) His = Histidine (H) le = Isoleucine (1) Leucine (L) Lys Lysine (K) Met = Methionine (M) Phe = Phenylalanine (F) Pro Proline (P) Ser = Serine (S) Thr Threonine (T) Trp Tryptophan (W) Tyr Tyrosine (Y) - Valine (V) UCA UCG UAA STOP UAG STOP UUA Leu UUG S CCU CC CGU CUU CUC His CGC Arg Leu Pro CAA Gin CGA CCA CCG CUA CUG CGG Leu = AGU AUU AUC } lle AUA ACU ACC ACA Ser AAC…When comparing (i.e., aligning) two or more genetic sequences, itis sometimes necessary to put in gaps. Explain why. Discuss twochanges (i.e., two types of mutations) that could happen during theevolution of homologous genes that would explain the occurrenceof gaps in a multiple-sequence alignment.