Q: 35. The differentiation of the primitive gonads into testes or ovaries depends on the presence or…
A: The Y chromosome have SRY gene which is referred to as the sex determination region. This is present…
Q: Describe the mycobacterial cell wall and give one reason why it is important in the treatment of the…
A: Introduction:Tuberculosis (TB), which is caused by the intracellular bacteria Mycobacterium…
Q: food, butter or margarine
A: Margarine usually tops butter when it comes to heart health. Margarine is made from vegetable oils,…
Q: A correlation between two variables implies that ... one variable may or may not directly affect the…
A: ANSWER;-d) One variable directly affects the other variable. Explain;- Connection is a factual…
Q: 1) Blood pressure is measured with a 2) What is the average normal blood pressure for adults? Label…
A: The heart is a muscular organ the size of a fist that sits directly behind and somewhat to the left…
Q: Which of the following lipids is NOT found in biological membranes? triacylglycerols…
A: Introduction Lipids are important to our body as they store energy, as well as are required for…
Q: During muscle contraction, which of the following processes takes place? Select one: O a. AMP…
A: Please follow step 2 & 3 for detailed explanation.
Q: Examine closely the dissected 5 different flowers for these characteristics based on: -…
A: Characteristics of the given specimens :-
Q: Larvae and pupae per Bt plant 100 Ö TOKH company -- Mosaic, Cry1Ac plant --- Mosaic, Cry1C plant --…
A: Mosaic treatment of plants and density of moths after treatment.
Q: Predict the effect on the activity of the lac operon of a mutation that disrupts the function of: a)…
A: The Catabolic Activator Protein (CAP) is a protein which acts as a positive regulating factor for…
Q: Two unlinked genes control flower color in snapdragons. You cross a true-breeding yellow flowered…
A: This is a case of recessive epistasis. The rr genotype for R gene is showing epistasis to the W…
Q: True or false cytokinesis is the process that divides the chromosomes equally between two daughters…
A: The cell division consists of two main steps the division of nucleus and the division of cytoplasm.…
Q: Match the letters in the empty boxes to the correct words or structures. A B C D E F G Citric acid…
A: Cellular respiration is a metabolic process in which glucose molecule is used up in the synthesis of…
Q: Which among the following CORRECTLY explains why herbivores have the ability to digest fiber while…
A: Cellulose is a complex carbohydrate. It is a polysaccharide composed of a linear chain of β-1,4…
Q: 5. When used for imaging, the wavelength of the radiation needs to be smaller than the thing being…
A: There are diverse types of bacteria,viruses,protozoa and other microbes exist in our…
Q: PART B Re-watch the video and explain why the following steps are necessary: Why use tweezers to put…
A: Please note as per the site regulations, external links are not watched. Hence, part A cannot be…
Q: II. ATP ACCOUNTING, Provide what is being asked for. Show all relevant calculations and summarize yo…
A: Aerobic cellular respiration includes glycolysis, Krebs cycle and ETC.
Q: The following statements are the events that occur during Mitosis. Which of the following is the…
A: Mitosis is the process by which a cell replicates its chromosomes and then segregates them,…
Q: The egfr kinase independent transactivation of the ras pathway does require egfr. Explain this…
A: EGFR is a cell surface receptor that binds to certain growth factors and sends signals to the cell's…
Q: Question 46 The monospot test is a rapid latex kit for the screening of [Select] for the presence of…
A: The monospot test looks for 2 antibodies in the blood.
Q: What kind of membrane protein is found entirely outside the bilayer on either the extracellular or…
A: Introduction Peripheral proteins are membrane proteins which attach only temporarily to the…
Q: Please answer fast Explain how the behavioral and/or physiological response of an organism is…
A: The behavioral and physiological response of an organism is important for its survival. The ability…
Q: 1. It is the creation of an offspring by fusion of haploid gametes, male sperm and female eggs, to…
A: Introduction Reproduction:- It is the process of producing new individuals of the same kind, an…
Q: II. ATP ACCOUNTING, Provide what is being asked for. Show all relevant calculations and summarize…
A:
Q: A perfect flower is one in which both ________ and ______________ are present.
A: Flower The flower is defined as the reproductive part of the plant which contains male and female…
Q: Question 10 What kind of membrane protein penetrates into the hydrophobic part of the lipid bilayer?…
A: Fluid mosaic model of plasma membrane was given by Singer and Nicolsan. It explains the lipid…
Q: Although exposure to both types of radiation can cause DNA damage, ionizing radiation and UV affect…
A: Ioninzing radiation are those which have higher frequency thereby they have higher energy, so that…
Q: Which will consume highest amount of 1₂ to become saturated? Which has the highest melting point?…
A: Saturated and Unsaturated fats Saturated fats are those that have single binds between their carbon…
Q: Consider the steps involved during the initiation of DNA replication. Explain what will happen if…
A: Introduction DNA replication is a process by which one DNA molecule replicates into two daughter…
Q: Question 6 Phospholipid bilayer is a fluid matrix. O True False
A: The lipid bilayer (or phospholipid bilayer) is a thin polar membrane made of two layers of lipid…
Q: please answer question b also. b. For the Covid-19 pandemic), give any issues, benefits, or…
A: Within the twentieth century, the world suffered pandemics. The pandemics, as horrifying and lethal…
Q: One of the carbon atoms of a glucose molecule is [C14] - labeled. If 14CO2 is released during the…
A: As we know that ,acetyl Co A is formed by beta oxidation of fatty acids or from glycerol utilized…
Q: 90% Arial 12 C | 1 | 21 3 4 5 6. 7 The list gives some structures in the blood and circulatory…
A: Answer : 1. The structure that can destroy bacteria is : White blood cells. The white blood cells…
Q: highlight the statement at the bottom
A: The circulatory system is formed by the heart, the lungs and the blood vessels. The lungs oxygenate…
Q: The cell cycle contains a series of events that control the division of cells. It is controlled by…
A: Cell cycle can be defined as as a sequence of events ,in which duplication of the genome of the cell…
Q: . Give the pathology in : 1 sentence each only g. purpura simplex h. Hereditary hemorrhagic…
A: Pathology can be defined as a branch of science which deals with the study of disease,its cause,…
Q: Peripheral proteins are proteins in the lipid layer facing inside the membrane True False
A: Cell membrane also called as plasma membrane are generally made up of by phospholipid bilayer in…
Q: Describe the step by step method of preparing culture media in microbiology.
A: Culture media are the media or the substrate used to grow microorganisms. There are different types…
Q: Activation of the fatty acid (converting it to fatty acyl-SCoA) requires the expenditure of 2 ATPs.…
A: There are 3 steps of beta oxidation of saturated fatty acids. This phenomena occurrs in the cytosol,…
Q: Cancer stem cells (CSCs) are cancer cells (found within tumors or hematological cancers) that…
A: Cancer is a condition in which cells proliferate abnormally and infiltrate, erode, and kill healthy…
Q: Milligram of base required to completely hydrolyze & neutralize 1 g of triglyceride/fat sample O…
A: Saponification is described as an hydration reaction, where ester bonds between fatty acids and…
Q: The following image shows Nondisjunction. Which of the following cells will suffer from a genetic…
A: Nondisjunction is a failure of chromosomes to separate during cell division. This results in the…
Q: Sexual reproduction in plants provides genetic variation. What are the benefits of this genetic…
A: Environment is faced by challenges everyday. These challenges directly get upon the species…
Q: Given this DNA strand: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ Identify the following: mRNA:…
A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…
Q: Assume that 2.5 ATPs are generated per NADH and 1.5 ATPs per FADH2. How many ATPs are generated from…
A: Beta oxidation is a catabolic pathway in which fatty acids are broken down to acetyl-coA. This…
Q: What is the function of chloroplasts? Which cell types have chloroplasts?
A: Because of specialized organelles, eukaryotic cells are more complicated than prokaryotic cells. All…
Q: Explain how the following conditions will affect the regulation of the operon. (3 pts) Low cAMP…
A: Lac operon is a mechanism seen in the E coli that enables the proper metabolism in its body. The…
Q: How would we explain using examples the non-Mendelian inheritance patterns such as incomplete…
A: Non-Mendelian inheritance It is defined as the inheritance pattern in which the traits are not…
Q: Explain Mendel's Law of Segregation and Independent assortment by connecting them to the process of…
A: Please follow step 2 for detailed explanation.
Q: A ADF F D Match the structure given with the name. Acetyl coenzyme A pyruvate Complex V of the…
A: The given structures in the figure are the structures involved in cellular respiration for the…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- 10:14 Protein 5-10092015113503.pdf https:api.schoology.comv1attachment169963838... Name Class Date RNA (pages 146-148) | SECTION REVIEW In this section you were introduced to the molecule that helps put the information in DNA to use: ribonucleic acid, or RNA. ANA Iis a nucleic acid that carries information from DNA to the ribosomes, the organelles in which proteins are made. RNA also carries out the process by which proteins are assem- bled from amino acids. RNA is quite similar to DNA in structure. However, there are some important differ- ences. RNA is single-stranded; DNA is dou- ble-stranded. RNA contains the sugar ribose; DNA contains deoxyribose. And RNA has the nitrogenous base uracil; DNA has thymine. In this section you also learned about the process of transcription. Transcription is t process in which part of a DNA molecule is used as a template for the synthesis of a com- plementary strand of RNA. This process is mediated by an enzyme called RNA poly- merase. The strand of…Second Letter EQ#10 G. UU UCU UAU Tyr UGU Cys Phe UUC UCC Ser UCA UGC UGA Stop UGG Trp UAC U UAA UUA Leu UUG Stop UCG UAG CGU CCU CCC CAU His CAC CAA CUU CUC Leu CỦA Pro ССА CCG CGC Arg CGA Gla CAG CGGJ Third CUG) First Letter Letter AAU Asn AAC AGU Ser AGC ACU ACC ACA ACG AUU AUC le AGA Arg AGG A AUA AUG Met AAA Lys AAG GGU GGC GUU GCU GAU GCC Ala GCA GAC Asp GAA Glu GAG GUC Val GUA Gly GGA G 15. Given the following (the start of a very long MRNA sequence), GUG GCG) GGG 5' CCGUAAGAUGGCGAACACAUUGUCAUCCAAUGC.... .... 3' what amino acid sequence would be produced in a cell? 16. If the red "U" in the RNA was changed to an A (due to a DNA mutation, for example), what would be the likely effect on the protein, and how might that alter the protein's function? UCAG UCAG UCAG UCAG 复5 C.Q8. Why do you think it takes three lines to display the amino acid information? Hint: remember that a codon is specified by three bases, e.g., CCG = Proline (circled in Figure 12).
- AGUC 24. Use the table below to answer the following question. The template strand of a gene contains this sequence: 3'-TAC TAG GCT AGT TGA-5'. A mutation occurs due to exposure to a chemical mutagen that changes the gene sequence to 3'-TAC TAG ACT AGT TGA-5'. How does this mutation affect the resulting amino acid sequence? (LS3-2) * Second mRNA base A UCU UGU Cys UGC UUU UAU Tyr UAC Phe UUC U UCC Ser UCA Phe Gly (G) Leu Glu (F) (L) UUA UAA Stop UGA Stop A Ser Asp (E) (D) Leu (S) UCG UUG UAG Stop UGG Trp Tyr (Y) Ala CUU CCU CAU CGU U (A) His C G U A CỤC Leu CUA CC Pro CCA CAC CGC Arg CGA Cys (C) G A Val CAA (V) Gln G Trp (W) CUG CCG CAG CGG G Arg (R) G А С A Leu AUU ACU AAU AGU (L) Asn Ser Ser (S) AUC Ile ACC Thr ACA AAC AGC C/ Lys (K) UGA AUA Pro AAA Lys AAG AGA Arg AGG Asn (N) (P) AUG Met or start ACG His Thr (T) Gin (H) (Q) GUU GCU GAU GGU lle Asp Arg (R) (1) GUC Val GUA GCC GAC GGC Ala GCA Gly GGA GAA Glu GAG GUG GCG GGG The mutation changes a single amino acid to another amino…PPPP 2.7 essage hatentaded pruteiis? gene iS shown below (starting with ATG), What is the resulting mRNA? From which strand was this MRNA generated? 5'-ATGCCATTCGAA-3' 3'-TACGGTAAGCTT-5' 21. What is meant by degenerate but not ambiguous?A scientist sequencing itiRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this itiRNA makes when it is translated?
- A fragment of bacterial DNA reads: 3’ -TACCTATAATCTCAATTGATAGAAGCACTCTAC- 5’ Assuming that this fragment is the template strand, what is the sequence of mRNA that would he transcribed? (Hint: Be sure to identify the initiation site.)GTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL protein sequence alignment for one of the…pcc300ATAAADATATAOOTTAA 1. Use the genetic code table and the information in the diagram below to determine the amino acids that would make up the portion of the polypeptide shown. Include information for a key as well. DNA template 3' G CATA ACAGAGGATT-5' al bnsua AMAm pniwollot erfT E transcription s yd bnsita ebitgeqylog s sidmeaze of beae RNA strandUU UAOUOUU A-emoaodin 5'-CGUA AUUGUC UCCUUA- 3' J J JL erit o elinW (s) translation bluow terdt aspnso sigootiwsone polypeptide viemetis ns ebivo19 (d) ent ot etslanT Key:
- Biol 1406-Lec 17 - Gene Exp X acconline.austincc.edu/ultra/courses/_891351_1/cl/outline Question completion Status. Blackboard Learn Which of the following stater X 9. Which of the following statements about transcription is not true? In both prokaryotes and eukaryotes, pre-mRNA is modified after transcription by adding a 5' cap and a 3' poly-A tail and splicing out introns leaving coding exons. Paraphrasing Tool - QuillBot Your disk is almos Save space by optir O During transcription only one DNA strand called the template strand is read and rewritten by RNA polymerase with the template strand read in the 3' to 5' direction and the mRNA transcript synthesized in the 5' to 3' direction. O During initiation of transcription, RNA polymerase binds to the promoter region in the DNA, unwinds the DNA and binds together RNA nucleotides complementary to the template DNA strand. O During initiation of eukaryotic transcription, the promoter region contains a TATA box in which transcription…BIOC 385 Deciphering the Genetic Code Q11.3: Describe the THREE experimental approaches used to decipher the Genetic Code32/ What molecules thought to have performed double duty as a genetic materal and performing catalyss of chemical ARNA B proteins C polypeptides D DNA E both proteins and polypeptides