Answered: Biological value of cerebrosides and…

Science

Biochemistry

Biological value of cerebrosides and gangliosides.

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter35: The Nervous System

Section: Chapter Questions

Problem 32CTQ: Alzheimer’s disease involves three of the four lobes of the brain. Identify one of the involved...

See similar textbooks

Related questions

Q: Consider a protein with two surface-exposed histidine residues: HisA is a “typical” histidine…

A: The Henderson-Hasselbalch Equation for the deprotonation of a species is given below. pH= pKa +…

Q: Convert 475 cal to joules

A: Calories, joules are used to determine the amount of energy present in the food . The energy given…

Q: Which of the following is an anomer of B-D-gulopyranose? O ОН I ОН т ОН I I ОН CH2OH II- Б ОН CH2OH…

A: Anomers are cyclic monosaccharides differing from each other in the configuration at carbon no -1…

Q: Which of these are artificial sweeteners (Arts) and which are metabolized (Mtbs) by glycolysis?…

A: Artificial sweeteners are synthetic substitutes for sugars. These are sweet in taste and have less…

Q: Arrange the following in the order they appear in electron transport. a. FAD, coenzyme Q, cytochrome…

A: Electron transport chain is a series of protein and organic molecules located in the inner membrane…

Q: The proton gradient across the inner mitochondrial membrane is produced.... by passing electrons to…

A: ETC consist of four protein complexes called Complex I, II, III and IV that transport electron…

Q: Which of the following first messengers is hydrophobic and binds to a nuclear receptor protein…

A: The first messengers are extracellular biomolecules that bind to the cellular receptor and elicit a…

Q: 4. Which one of the following requires an energy source? a. a large molecule transported with its…

A: Transport of molecules across the plasma membrane occurs through passive and active transport.…

Q: Structure, localization and biological significance of glycogen.

A: Introduction Cell needs energy for various metabolic processes. Glucose breaks into pyruvate and…

Q: Coupling ATP hydrolysis to glucose phosphorylation makes thermodynamic sense, but consider how the…

A: INTRODUCTION : Glucose phosphorylation in Glycolysis - In the cellular mechanism of Glycolysis, the…

Q: How do enzymes typically relate to the manipulated variables? our manipulated variables were…

A: Enzymes are high molecular-weight protein molecules that catalyse biochemical reactions. The…

Q: Which of the following is 18:248,11?

A: Fatty acids can be named and numbered in 2 ways. Fatty acids have a carboxylate end (COO- ) and a…

Q: n oil obtained from salmon is unusual in that all three fatty acid components are identical. The…

A: Introduction Lipid is one of the important biomolecule in our body. Lipid is present in the plasma…

Q: true/false: The carbon skeleton produced by catabolism of asparagine enters glycolysis as…

A: Anaplerotic reactions are reactions that produce intermediates of TCA cycles. Conversion of…

Q: Provide the principle of biuret test used to detect RNA. Explain in 5 sentences essay

A: The biuret test is used to detect substances that have peptide linkages. To evaluate the aqueous…

Q: ----------------------the simplest lipids but they may be a part of or a source of many complex…

A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…

Q: Explain the importance of solubility in drug product formulation. 2.

A: Solubility, the phenomenon of dissolving a solute in a solvent to produce a homogeneous system, is…

Q: a) This molecule is produced when what amino acid is transaminated? b) What are the one- and…

A: Introduction Amino acids are the building blocks of protein. Two amino acids are joined by peptide…

Q: What do you call the test used to detect the presence of protein in saliva?

A: Proteins are high molecular weight biomolecules. They are polymers of amino acid residues linked to…

Q: Draw the electron pushing mechanism

A: Electron pushing mechanism shows the jumping of electrons in the substrate and reaction…

Q: 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above…

A: In our body genetic information is stored in form of DNA. DNA multiples itself by replication. DNA…

Q: 1 which parts of amino acids are involved in tertiary structures ? 2 polar side chain can make…

A: Amino acids are biomolecules that have an amino group and a carboxyl group linked to the same carbon…

Q: * 15-14 AG AG is +6.64 kJ/mole +1.59 kcal/mole for the reaction Citrate - = Isocitrate. is -267…

A: Since conditions inside the cell are different than standard temperature and pressure, biochemists…

Q: What statement is true regarding LDL? Because the LDL is plasma lipoproteins with a lipid bilayer,…

A: Lipoproteins are triacylglycerols, phospholipids, cholesterol, and cholesterol esters associated…

Q: 1. Discuss fully the synthesis of triacylglycerol in the adipose tissue, muscles, intestines and…

A: All animals can synthesize triacylglycerol. Triacylglycerol is formed by linking glycerol and fatty…

Q: If a slight deficiency in the Vitamin B1 derivative Thiamine Pyrophosphate (TPP) leads to an…

A: TPP is a cofactor used by many enzymes. TPP helps to cleave bonds near to a carbonyl carbon.

Q: Draw the electron pushing mechanism

A: Electron pushing mechanism shows the jumping of electrons in the substrate and/or reaction…

Q: Which of the following first messengers is a polypeptide? O acetylcholine adrenaline O insulin…

A: First messengers are biomolecules that bind to the cellular receptor to elicit a response within the…

Q: (a) 2,3-Bisphosphoglycerate (BPG) reduces binding of O₂ to hemoglobin from almost hyperbolic to…

A: Hb is a protein responsible for carrying both O2 and CO2 in blood. 1 Hb protein is composed of 4…

Q: You are running a size exclusion column to purify your 25 kDa protein from a lysate mixture. The…

A: Size exclusion column chromatography: As a function of their respective sizes, molecules are…

Q: Choose the statements that describe why the isomerization reaction is critical for the subsequent…

A: Glycolysis is the collection of 10 enzymatically catalysed reactions that sequentially oxidises a 1…

Q: true/ false: When proteins are denatured 1°, 2°, 3°, and 4° structure is lost.

A: Denaturation is a process in which proteins lose their original structure or confirmation. The loss…

Q: Describe how the results of carbon-14 labeling experiments demonstrated that the citrate cycle is a…

A: The citric acid cycle involves the oxidation of acetyl-CoA into carbon dioxide and water. It is the…

Q: An individual's blood sugar is low. Assuming normal regulatory patterns, are the following ratios…

A: If the blood glucose level is low, we need to reduce the rate of glycolysis as there is insufficient…

Q: What are the biochemical cycles?

A: Biochemistry is the way of understanding of different chemical reactions that occur within the…

Q: Please describe four different modes of the regulation of the pentose phosphate pathway.

A: Introduction:- The Question is all about the pathway of pentose phosphate cycle that synthesis via…

Q: Using Haworth projections, draw the structure of an a-disaccharide of mannose B(1,2) galactose…

A: Carbohydrates or carbs are macronutrient consisting of Carbon, hydrogen and oxygen atoms. In nature…

Q: f What advantage is there to phosphoglycerate kinase having an open and closed protein…

A: Glycolysis is the 10-step enzymatic conversion of 1 molecule of six-carbon glucose to two molecules…

Q: -. Succinate dehydrogenase contains iron-sulfur centers in which irons are complexed with cysteine…

A: Succinate dehydrogenase have three 2Fe-2S centers. The 'Fe' here is complexed with the sulfur atom…

Q: Which reaction or reactions of glycolysis require NAD* as a reactant? Which reaction or reactions in…

A: Cellular respiration is the process how biochemical energy is generated from food. It involves the…

Q: Upon doing the experiment of Protein Denaturation, what could happen in the precipitation of strong…

A: Denaturation is the disruption and unfolding of a protein, resulting in the loss of its biological…

Q: 4. Amphiphilic Lipids. Detergents are small amphiphilic molecules that tend to form micelles in…

A: Ionic detergents contain anionic or cationic head group long with their hydrophobic tails being…

Q: The specific activity of a pure preparation of pyruvate kinase (PK) assayed in the direction of…

A: Pyruvate kinase (PK): The role of pyruvate kinase is to catalyze the final phase of glycolysis,…

Q: The first step in the catabolism of most amino acids is which of the following? Transfer of alpha…

A: Amino acids are biomolecules that have an amino group, a carboxyl group and a side group linked to…

Q: II. Draw the different forms of the following amino acids in solution. 1. Proline (3 forms)

A: Since in the question, it is mentioned to write about the 3 forms of proline, only answer to that…

Q: Metabolism is best defined as a collection of Ocellular processes that activate cell division.…

A: Biochemistry is an attempt at explaining the living cell in chemical terms. A living cell is the…

Q: po Which of the following non-covalent interactions is the driving force in the initial…

A: A protein's function depends on its structure. There are four levels of protein structure: primary,…

Q: Identify examples of a carbohydrate that is: unbranched, reducing monosaccharide

A: Chemically, carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…

Q: In the experimental set up to show that "CO, is given out during respiration", name the substance…

A: Respiration is a metabolic process that all organisms go through. It is a biochemical process that…

Q: Structure and biological role of phosphatidic acid.

A: The smallest and most basic phospholipid, phosphatidic acid (PA), serves as a precursor for other,…

Question

8. Biological value of cerebrosides and gangliosides.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.

Similar questions

11. Mood enhancers include the following drug classes: 12. The most commonly used mood stabilizer for bipolar mania is:
6) Why is depression often mistaken for dementia?
7. Structure and formation reactions of phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine.
12. Parkinson’s disease is caused by the deficiency of which of the following neurotransmitters?• Acetylcholine• Dopamine• GABA• Serotonin
31. what neurotransmitters does monoamines affect and their functions?
133. A 55-year-old woman is brought to the physician by her husband because of a 1-year history of progressive memory loss and cognitive problems. Her husband says that she has been extremely forgetful and often loses her keys or does not remember where she parked the car. Physical examination and laboratory studies show no abnormalities. A tentative diagnosis of dementia, Alzheimer type, is made. Treatment with memantine is started. Which of the following is the predominate excitatory neurotransmitter in the human brain whose action is blocked by this drug? A) Acetylcholine B) y-Aminobutyric acid C) Dopamine OD) Glutamate E) Norepinephrine
15. Explain the biosynthesis of acetylcholine.
7- Explain how MPTP became one of the gold-standard model of Parkinson's disease?
The conscious perception of pain is often delayed because of the time it takes for the sensations to reach the cerebral coitex. Why would this be the case based on propagation of the axon potential?
Watch this video (http://openstaxcollege.org/l/3Dmovies) to learn about the side effects of 3-D movies. As discussed in this video, movies that are shot in 3-D can cause motion sickness, which elicits the autonomic symptoms of nausea and sweating. The disconnection between the perceived motion on the screen and the lack of any change in equilibrium stimulates these symptoms. Why do you think sitting close to the screen or right in the middle of the theater makes motion sickness during a 3-D movie worse?
Alzheimer’s disease involves three of the four lobes of the brain. Identify one of the involved lobes and describe the lobe’s symptoms associated with
Which neurotransmitter is important in reward-based learning and drug addiction? a. ACh b. serotonin c. dopamine d. epinephrine