below with the correct term. There is a single trait on the tree (Y) and the number of primes after it indicate different versions of the the trait. Remember the example in class of the trait number of toes for sloths. synapomorphy 'Y' Xy!!! Y' and Y"
Q: Match the tissue shown with its function. option: 1. Present in bone marrow, spleen, and lymph…
A: Immune system consists of defense system in a host consisting of a widely distributed cells, tissues…
Q: The figure below resulted from researchers dating old-growth forests in Pennsylvania. The thickness…
A: The given figure is a bar diagram which shows four types of trees in the forests of Pennsylvania and…
Q: The following is correct regarding the oxidoreductase enzymes: A. NADH + H+/NAD+ are involved in…
A: Enzymes are chemical substances that serve as biocatalysts to increase the rate of a chemical…
Q: an experiment to test the effectiveness of a medication, researchers may use both a standard control…
A: In any experiment there is relevance of all the standard treatment control groups and the placebos…
Q: What pathologies are present in the Egyptian mummies? Select ALL that apply. A. Clogged…
A: The question is asking about the various diseases or pathologies that have been identified in the…
Q: ou are studying an interaction between a plant, its pollinators (bees), its seed spersers (ants),…
A: In nature certain organisms live in close association with each other. In such kind of relationships…
Q: Discuss the Structures which prevent regurgitation of food
A: In vertebrates, throughout the swallowing and digestion process, a number of structures and systems…
Q: 6. Provide three primary categories of sources of outdoor air pollution.
A: The objective of the question is to identify the three primary categories of sources that contribute…
Q: Constricting the efferent arteriole will decrease, increase increase, increase decrease, decrease O…
A: The kidneys play a crucial role in maintaining the body's acid-base balance, ensuring optimal…
Q: Based on the pET-28a map and based on the nucleotide sequence of the OXA-M290 gene, could the…
A: To determine whether the restriction enzymes Sac I and Hind III can be used for cloning the OXA-M290…
Q: Dicuss the Neural control of breathing in animal
A: Respiration is critical for all animals since it permits for the exchange of gasses, including…
Q: he figures below show a tobacco hornworm that can only eat well chemically efended tobacco plants…
A: This exercise is all about a generalist and a specialist species. Generalist species are more…
Q: Looking at the image of results of an experiment: A. What Hypothesis is being tested in the…
A: Tamoxifen resistance is a major challenge in the treatment of breast cancer. The Akt/p70S6K…
Q: What is garbology? Define what this is and why it is important as a field of discipline. Minimum 2…
A: Garbology is the study of modern refuse and trash. As an academic discipline, it involves the…
Q: Explain the multiple testing problem of GWAS - why do we need such a small p-value to achieve…
A: Imagine you're flipping a coin a bunch of times. If you only flip it once, getting heads might not…
Q: What are the differences in plasma glucose contents, plasma β-hydroxybutyrate contents and plasma…
A: Normal Feed Rats: In rats that are regularly fed, plasma glucose levels are typically within a…
Q: he LD50 of a certain substance is appreciably higher by inhalation than by ingestion. What…
A: The LD50 (lethal dose for 50% of the population) of a substance being significantly higher by…
Q: For a neutrophil to phagocytose a bacterium, it must have: For a neutrophil to phagocytose a…
A: Neutrophils are a type of white blood cells. They contain granules and are called granulocytes. They…
Q: compare Lucy's anatomy with other hominins. Choose at least two other species and three bones and…
A: The objective of this question is to compare the anatomy of Lucy, a specimen of Australopithecus…
Q: Describe the role of brainstem nuclei in descending motor control
A: We are authorized to answer one question at a time as per Bartleby policies. Kindly post the other…
Q: Discuss the Respiratory muscles
A: Respiratory muscles are responsible for the mechanical aspects of breathing, facilitating the…
Q: Membrane Receptors and Medicine. A patient, who has a stressful job, comes in with high blood…
A: The use of beta-blockers in the management of hypertension represents a pharmacological approach to…
Q: A 48-year-old woman visits her physician complaining of what she calls “panic attacks.” She reports…
A: When the blood vessel pressure is very high (140/90 mmHg or above), you have hypertension, or high…
Q: The B-cell co-receptor, composed of CD19/CD21/CD81, is a receptor that binds to complement fragments…
A: A co-receptor is a type of cell surface receptor that functions by binding a signaling molecule in…
Q: Commensalism is: An interaction that has no effect on either of two species. An interaction that…
A: Members of biotic community, interact with each other, mainly for food, space, reproduction and…
Q: Compare the 95% confidence interval for the difference between two true means with the 95%…
A: Confidence intervals are essential tools in statistics for estimating the range within which a true…
Q: For the following sets of partial diploid bacteria, is the Z gene constitutive, inducible, or…
A: An inducible gene is a gene that can be turned on or off in response to specific signals or…
Q: 4. Chris and Emma are phenotypically normal but carriers for SCA (gene A). a. What are their…
A: Sickle cell anemia (SCA) is a genetic disorder that affects hemoglobin, the protein in red blood…
Q: Filtration is favored by increasing the pressure in: the glomerulus Bowman's capsule neither the…
A: The glomerulus plays a crucial role in the kidney's filtration process, meticulously filtering blood…
Q: vitamins
A: Vitamins:These are essential organic compounds which are important for various body functions.These…
Q: Use the property of particle size to explain the selective-permeability of cell membranes.
A: Cell membrane is also called as plasma membrane. It is found in all cells and separated the interior…
Q: Please answer this following questions in your own words: Question 1: During the early years of…
A: Disclaimer: According to Bartleby guidelines, only the first question can be answered; please ask…
Q: Hereditary canine spinal muscular atrophy (HCSMA) is a motor neuron disease in Brittany Spaniels.…
A: Hereditary Canine Spinal Muscular Atrophy (HCSMA), a motor neuron disease affecting Brittany…
Q: 5. You sequence the following piece of DNA from E. coli: CGT TAC AAT GAA CCT ATA TGA ACT ATT GCC TTC…
A: The problem displayed includes the investigation of a DNA sequence from E. coli. The task is to…
Q: Summarize the major types of selective cell-cell adhesions. Describe the structure and role of…
A: Cell-cell adhesions are important molecular interactions that allow cells to adhere together and…
Q: table actions menu Name Daphnia Trial 1 HR Daphnia Trial 2 HR Daphnia Trial 3 HR Average Heart Rate…
A: In this step, we introduce the process of collecting data related to different concentrations of a…
Q: Discuss the Direct and indirect respiration
A: Respiration is the process of gaseous exchange that is intake of oxygen from the atmosphere and…
Q: Skull parts are represented in only___ of the more than 100 genera of sauropods (A) 20 (B) 24 36 D…
A: Sauropods were a diverse group of long-necked, herbivorous dinosaurs that lived during the Mesozoic…
Q: In a particular breed of dogs, having spots is a dominant trait (S) and having no spots is recessive…
A: Monohybrid crossing involves the analysis of only one trait of an organism. Based on the monohybrid…
Q: Select the term that correctly identifies each of the shown organisms. Terms may be used more than…
A: The task at hand includes analyzing three particular pictures of life forms and deciding whether…
Q: Using medical terminology, our ears are located ________ to our nose. posteriorly anteriorly…
A: In simple terms, when we talk about the position of body parts, it's essential to use clear…
Q: 2. An individual heterozygous for 4 genes ABCD was testcrossed, and the progeny were classified by…
A: The issue raised is a typical illustration of heredity mapping, a method utilized in genetics to…
Q: What are the different types of vertebra based on the shape of centrum?
A: Vertebrae are the individual bones that make up the vertebral column, also known as the spine or…
Q: Which of the following are examples of protists producers? Amoeba spp. Cyanobacteria spp.…
A: Protists are a diverse group of eukaryotic microorganisms that do not fit into the traditional…
Q: You are comparing the proteins expressed in two different human cells: a liver cell and a muscle…
A: Proteins are cellular macromolecules made up of amino acid polymers (polypeptides). The sequence of…
Q: 3. The allele b gives Drosophila flies a black body and b+ gives brown, the wild-type phenotype. The…
A: If the genes are located on the same chromosome then they are classified as linked genes and the…
Q: A bacterial culture is heated up, resulting in protein denaturation and loss of protein function,…
A: In this situation, a bacterial culture is subjected to heat, leading to the denaturation of proteins…
Q: Which of these do you suspect will not lead to an increase in ADH secretion from the posterior…
A: ADH or antidiuretic hormone is released from the posterior pituitary gland. It is responsible for…
Q: set of true breeding white cows were crossed with true breeding black cows to produce all brown…
A: In this type of cross, if there was complete dominance shown then in the F1 ratio the dominant…
Q: 1) Summarize the main point of the study in two or three sentences. (Make sure you use your own…
A: Summery of the paper:In this study the authors wanted to test the evolution of the the plant…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- In the phylogeny shown, how many species lack males that grow horns? Threshold mechanism 1 Threshold mechanism 2 Coprapkanana emn Saleaph en Ogste pinkr thoyn palare hyn plan Phanon palemo Phaneos kiry Phene pros Phanus qeadride Phanan dr Phanonur vinder Phan w Pun Phener chel e Phanon drn Phanan ei Phan Phanen Phan farienss Phann es Caption: Evolution of two thresholds mapped onto a phylogeny of 22 species of phanaeine scarabs with indicators for horn size. a. None O b. 11 Oc. All O d. 7 О е. 2 0000Study the provided taxa image to determine which of the listed traits it exhibits and fill in the table below. You must get them all correct in order to advance. Hint Provided Taxa Ability to fly (Y/N) Hindwing (S/T) Antenna (Y/N) Y Submit S Y Wing width (N/EW) Distinctive markings (N/STR/V/EYE)|| N A HAI EMap the derived characters for the 7 imaginary species listed below onto each of the two trees. G is the outgroup for this analysis. Species # toes # premolars canines # vertebrae tooth hooves horns shape ridges ridges ridges bumps bumps bumps bumps <5 7 present present absent present present present absent present present absent <5 7 3 7 5. absent absent 7 E present 6. absent absent F 4 6. absent absent present present 5. absent 4 absent Questions 1. How many total changes are required for each tree ? 2. Given your answer to question 1, which tree is a better supported hypothesis of evolution for these species ?
- Mammalian species possess an amniotic, a character state also inferred to have been present in the ancestor they share with Reptilia. Thus, this shared homologous trait is a______________of Mammalia. Group of answer choices symplesiomorphy synapomorphy analogy homoplasy PreviousNextC D E F G H А В Chordates Match the extant taxa.On the right is a phylogeny depicting the relationship among eight animal species (A to H). Next to the species names are the tooth morphology of each species. For example, species A has prominent molar teeth, thus likely a herbivore. On the other hand, species C has prominent canine tooth, thus likely a carnivore. Which of the following statements is correct? O The most recent common ancestor for species A to H is probably a carnivore: O The most recent common ancestor for species A to H is probably a herbivore OIt is impossible to tell what the main food source is for the most recent common ancestor of species A to H. O For species C, D, E, F, G, there are four evolutionary events that lead to the evolution of canine tooth morphology If the common ancestor of species C, D, E, F, G is a carnivore, then the molar teeth for species D is a plesiomorphy. A B D E LL F G H REG a a B
- What is the function of including an outgroup in this phylogeny? After all, the point of the phylogeny is to see which Galapagos finch species are most closely related to each other.Please use the following data table of mesodermal patterning and homeobox genes to help you reconstruct a most parsimonious tree of basal Animals: "1" means the gene is present in that taxon, and "0" means it is absent. Please use these taxa as tips on your tree and indicate where on the tree each gene evollved. Mesodermal patterning genes and Homeodomains (Homeobox genes) Таха COL TALE AMPA POU Erb-B HNF PROS SINE CASK GRIP S-50 recep. recep. PRD Bilateria 1. 1 1 1 1 1 Choanoflagellata 1 1 1. Cnidaria 1 Ctenophora 1 1 1 1 1 Placozoa 1 1 0. 1 Porifera 1 0. 0. FungiPlease help to creating parsimonious treesFor the following DNA sequences determine the most parsimonious phylogeny. Tree ASpecies 1 AATTGCGGGATATATCGCGGGGAAATTTACGACTSpecies 2 AATGTCGGGATATATCGCGGGGAAATTTACGACTSpecies 3 AATTGCGGGATATATCGCGGGGAAATTTACGACT Tree BSpecies 1 AATTGCGGGATATATCGCGGGGAAATTTACGACTSpecies 2 AACTGCGGCATATATCGCGGGGAAATTAACGACTSpecies 3 AAGTGCGCCATATATCGCCCGGATAATTTCGAGA Tree CSpecies 1 CCGTATGACCGGGTATAAATCGCGCCCGGGATCTGCSpecies 2 CCGTATGAGGGGGTATATATCGGGCGCGGGATCTGCSpecies 3 CCGTATGACCGGGTATAAATCGCGCCCGGGATCTGCSpecies 4 CCGTATGAGGGGGTATATATCGGGCGCGGGATCTGC Tree DSpecies 1 GGGATATAGCGCACGATATCGTAGCCTAACGTTTTACGSpecies 2 GGGATATAGCGCACGATATCGTAAGCTAACGTTTTACGSpecies 3 AAAATATAGGCGTGGATATCGTAGCCTAACGTTGCATTSpecies 4 GGGATATACCGCACGTTATCGATCCCTAACGTTTTACG
- Morphological Information Baltimore Oriole Black-backed Oriole Female Male Kondo, Baker, & Omland 2004 2B. Based on the morphological information above, should the Baltimore Oriole and Black- backed Oriole be classified as one species or two species? What if we only had information about females?A phylogeny of 5 species of birds is shown below with values for three different phenotypic traits for each species shown in the rows above (e.g., species A has a wide, long beak and red tail, while species C has a narrow, very long beak and a green tail). DNA sequencing of tissue samples found buried in a freezer confirms that an extremely rare and reclusive species (D) is a sister species of E, but preserved samples of entire individuals of species D have been lost, the original collector of the samples has passed away, and no individuals of species D have subsequently been seen in the wild. In other words, we have no idea what species D looks like. Employing the principle of parsimony, which of the following conclusions is MOST appropriate for the likely values of these traits in species D? Beak width: wide wide ?? narrow narrow Beak length: long long ?? long very long Tail colour: red blue ?? green green A E a) wide beak, very long beak, green tail b) narrow beak, long beak, all…Among a population of tadpoles, the correlation coefficient for size atmetamorphosis and time required for metamorphosis is −0.74. On thebasis of this correlation, what conclusions can you draw about therelative sizes of tadpoles that metamorphose quickly and those thatmetamorphose more slowly?