Be sure to answer all parts. Consider the following mRNA sequence: 5'-GCU AGG CGA-3'. a. What amino acid sequence is coded for by this mRNA? b. What is the amino acid sequence if a mutation converts GCU to GCA? c. What is the amino acid sequence if a mutation converts AGG to ACG? d. What is the amino acid sequence if a mutation converts CGA to GGA? e. What occurs if A is added to the beginning of the chain? a. b. с. d. е.

Be sure to answer all parts. Consider the following mRNA sequence: 5'-GCU AGG CGA-3'. a. What amino acid sequence is coded for by this mRNA? b. What is the amino acid sequence if a mutation converts GCU to GCA? c. What is the amino acid sequence if a mutation converts AGG to ACG? d. What is the amino acid sequence if a mutation converts CGA to GGA? e. What occurs if A is added to the beginning of the chain? a. b. с. d. е.

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 7P

See similar textbooks

Similar questions

Be sure to answer all parts. Write a possible mRNA sequence that codes for each peptide. a. His-Cys-Tyr-Val-Ser 5¹- b. Phe-Val-Thr-Tyr-Glu 5'- 5'- c. Trp-Phe-Asn-Gln -3' U -3' с Table 26.2 The Genetic Code-Triplets in Messenger RNA First Base (5' end) -3' U UUU UUC UUA UUG CUU CUC CUA CUG AUL Phe Phe Leu Leu Leu Leu Leu Leu la C UCU UCC UCA UCG CCU CCC CCA CCG Second Base A UAU UAC UAA UAG CAU CAC CAA CAG Ser Ser Ser Ser Pro Pro Pro Pro Tyr 55 Tyr Stop Stop His His Gin Gin G UGU UGC UGA UGG CGU CGC CGA CGG Cys Cys Stop Trp Arg Arg Arg Arg Third Base (3¹ ond) DUAC DU AG с А А
All about splicing A. snRNPs interactions will bring the 5' and 3' splice sites together in the pre-mRNA B. lariat formation is necessary to bring the branch site with the 5' splice site of the intron C. an unstable 5'P and 2'OH phosphodiester bond helps form the lariat D. exon 5' splice site consensus sequence GU and its 3' splice site AG are recognized by snRNPs E. various types of snRNPs and the pre-RNA come together to form the spliceosome B, C, D, E only A, B, C, E only A, B, C, D, E A, B, C only
Need help:. Researchers add poly-(CGU) to an in vitro TL system. What poly-amino acids are produced? How would the researchers determine which codon encoded each of these amino acids? 5’CGUCGUCGUCGUCGUCGUCGUCGU...3’
Hi, help please. Which of the following is TRUE regarding RNA editing? a .The coding sequence is altered in the chromosome b. More than one answer choice is correct c. The mRNA is altered by Guide RNAs d. Translation first takes place, following by altering of the coding sequence
PLEASE ANSWER ALL OF THEM. THEY ARE ALL CONNECTED MUTATION: Fill in the correct nucleotide base pairing and amino acid sequence of the mutated DNA. 1.. What is the 3’-5’ DNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) 2. What is the mRNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) 3. What is the tRNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) 4. What is the amino acid sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) 5. What is the most convincing type of mutation had occurred? (Frameshift resulting Missense; Frameshift resulting Nonsense; Substitution – Silent; Substitution – Missense; Substitution – Nonsense)
An extra piece. In one type of mutation leading to a form of thalassemia, the mutation of a single base (G to A) generates a new 3' 3' splice site (blue in the illustration below) akin to the normal one (yellow) but farther upstream. Normal 3' end of intron 5' CCTATTGGTCTATTITCCACCCITAGGCTGCTG 3' 5' CCTATTAGTCTAIIIICCACCCTTAGGCTGCTG 3' What is the amino acid sequence of the extra segment of protein synthesized in a thalassemic patient having a mutation leading to aberrant splicing? The reading frame after the splice site begins with TCT.
Fill in the blanks. An _______is a cluster of bacterial genes along with an adjacent promoter that controls the transcription of those genes. 2. __________ is the sequence prior to the initiation site that correctly aligns bacterial mRNAs on ribosomes. 3. __________is a group of ribosomes bound to an mRNA molecule.
Please help me discuss this 2 question. Thank you so much. 1. how does pre mRNA is formed in the nucleus and the RNA processing that happen to form a matured RNA. 2. Relate the structure of the three RNA to their function in building of Polypeptide and point out the characteristics of a genetic code and their function in translation.
RNA is transcribed. Label the 5′ and 3′ ends of each strand. 17. The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. a. Which end of the DNA template is 5′ and which end is 3′? b. Give the sequence and identify the 5′ and 3′ ends of the RNA transcribed from this template.
GTTTTCACTGGCGAGCGTCATCTTCCTACT 8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.
Sources of Variability 1. If a point mutation occurred so that adenine was changed to thymine in the amino acid triplet code CTA, what would the resulting amino acid be? 3. What is the complementary DNA code for the following base sequence (from a section of DNA)? ATG C C C G G C CT TATTTTCTACA TGGT b. What is the complementary mRNA code? c. What is the tRNA code for this sequence? ACTT
I am more confused. how about we start from begining, you post answers on here, and then we go from there? 1. Identify the open reading frame in the following DNA sequence, the protein that this gene encodes for, its function, and the source. 2. "Look carefully at the DNA sequence and identify the start site for transcription" 3. Click on the DNA sequence from the start site of transcription, select all of the sequence, and copy the sequence. Go to the National Center for Biotechnology Information (NCBI) website http://www.ncbi.nlm.nih.gov/. Click on BLAST on the right-hand side under “Popular Resources.” BLAST is a program that will allow you to find the protein sequence for the DNA sequence (gene) you submit. Next click on blastx (translated nucleotide protein). Paste the DNA sequence into the box under “Entry Query Sequence.” Scroll down and click BLAST. The search may take a few seconds; the page will keep updating until the search is completed. You do not need to enter any…