Q: PART OF THE SOLAR SPECTRUM PROVIDING BACTERICIDAL ACTION 1. visible light 2. infrared rays 3.…
A: A bactericide, commonly known as a bacteriocide or Bcidal, is a chemical that destroys bacteria.…
Q: Name a microbe used for the production of Swiss cheese.
A: Many products, such as food, cosmetics, pharmaceuticals, and construction machinery, are created…
Q: A bacterium that can form endospores likely has the ability to; withstand high temperatures resist…
A: Bacteria is a prokaryotic cell with few micrometer in length and can exist in various shapes and…
Q: Micro -endotoxin
A: Microendotoxin refers to pyrogen molecule (fever inducing agent) found in Gram negative bacteria.
Q: Why is staining a specimen helpful for microbiologists? This is only done for laboratory decoration,…
A: Why is staining a specimen helpful for microbiologist?
Q: atch the descriptions given below to either the capsule or slime layer. Capsule Slime layer easily…
A: Bacteria are microscopic single-celled prokaryotes that thrive in diverse environmental conditions.…
Q: 25 g of sugar sample was obtained from the production line for analysis of raw ingredients. It was…
A: Sulfide spoilage bacteria are responsible for the damage of canned food by producing hydrogen…
Q: Which of the following is most susceptible to antimicrobial agents? mycobacteria bacterial…
A: INTRODUCTION Vegetative bacteria A normally growing bacterial cell that forms endospore is called…
Q: A certain culture of the bacteria stripped her classes and national has 10 bacteria to double every…
A: Bacteria divide by binary fission. This means each cell divides into two identical daughter cells.…
Q: Silver may be used to coatingendotracheal tubes. Silver is an excellent antimicrobial againsts a…
A: Silver is a bacteriocidal (that kils bacteria) metal. It functions by punching holes in bacteria and…
Q: Bacterial capsule helps in adherence of bacteria to surface in its environment. It also protects the…
A: First statement is true. Second statement is false. Bacterial capsule helps in adherence in its…
Q: Microbiology Why are mycobacterium (mycobacterium sp) harder to control than other bacteria?
A: Mycobacterium tuberculosis causes tuberculosis. Tuberculosis (TB) is an acute or chronic bacterial…
Q: Eubacterial ribosomes can be inactivated by all of the following antibiotics except:…
A: Microorganisms are small organism that cannot be seen by naked eyes. They include bacteria, fungi,…
Q: Which of the following statement/s is/are true about gram negative bacteria
A: This question is based on cell wall of gram negative bacteria.
Q: my mom recently bought young living products, they are claiming that they are really good against…
A: Covid-19 has caused a pandemic and is still into the picture. this means that since one year the…
Q: 45years old male had been working e his garden when he scratched the knuckle of his right aram…
A: The morphological differences could be easily found by doing the Gram stain. It is dependent on the…
Q: THE SPECIFIC POWER BACTERICIDAL LAMP CLOSED TYPE, SHIELDED BE LESS THAN (W / M ') 1. 1 2. 2-2,5 3. 4…
A: UVGI stands for Upper room ultraviolet germicidal irradiation.
Q: Why are desease causing flagellate bacteria considered "dangerous"? What are 5 examples of desease…
A: The filamentous cytoplasmic structure, known as the flagella, protrudes through the cell wall of the…
Q: Biological Hazards: I need example about Bacteria
A: What are biological Hazards:- Biological hazards are also known as biohazards. it is biological…
Q: Enriched media boosts the growth of a particular bacterial species.
A: Enrichment culture media is use for growing certain favourable, (perticular microorganism) over…
Q: What type of microbes are often withstand and survive high pressure treatment?
A: Microorganisms are killed by high hydrostatic pressure. This pressure-instigated inactivation is…
Q: In experimental microbiology classification of bacteria is very important. Why is essential to…
A: The microbes and E.coli both are prokaryotic organisms which give us a different field of…
Q: The rough strain of Streptococcus pneumonia is not pathogenic because it lacks the present on the…
A: Streptococcus pnumonia have a virulent type strain that causes pneumonia diseases. Virulent strain…
Q: GRAM STAINING REACTION SUMMARY OF PUBLIC HEALTH AND MEDICALLY IMPORTANT BACTERIA GRAM (+) COCI GRAM…
A: List of medically important bacteria with reference.
Q: Staining microbes are important techniques to characterize microbes in any microbiology laboratory.…
A: According to the question, we have to mention which of the four staining procedures is the most…
Q: Different media in bacteriology
A: Culture Media: Culture media, also known as growth media, are particular combinations of nutrients…
Q: an Gram negative organisms.
A: M, Eosin Methylene Blue (EMB) agar is a differential microbiological medium, which slightly inhibits…
Q: What is the correct family of the bacteria image below? (Bases on what was presented in the Lecture…
A:
Q: New villas in Hidd area stood on unstable reclaimed sand. Those villas are susceptible to sink in…
A: Ecology is the study of interaction of organisms with one another and with the environment. Ecology…
Q: hese bacteria can live in areas with very minimal concentration of oxygen.
A: Bacteria are small, microscopic organisms. They are found in various shapes and structures.
Q: A typical human body carries how many bacteria;
A: The microorganisms that are known to reside in the human body and perform the function of…
Q: UNSAVED FILE This is a recovered file that is temporarily stored on your computer. Save Mark all…
A: In cell different organelles perform different function or are site of different metabolic activity…
Q: You observe an area of no bacterial growth on ar agar plate after incubation with a bacteriophage…
A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…
Q: mycobacterium tuberculosis Gram staining status OR acid-fast stain cell wall description. Explain…
A: The etiologic agent of tuberculosis in humans is Mycobacterium tuberculosis. The bacterium's only…
Q: Which microbiology test measures the use of LACTOSE? What color is positive in each?
A: Lactose is a naturally occurring sugar present in dairy products such as butter and desserts.…
Q: Thank you very much for your help How does each of the differences between prokaryotes and…
A: Microbiology is the branch of biology that deals with study of organisms that are too small to be…
Q: BIO 211 Bacteriology Self Study: Use your text and lecture notes as reference to complete the table.…
A: the cocci group of bacteria are found in close association with humans and animals. most of the…
Q: All except which of the following are important aspects to consider in determining the G+C content…
A: The G + C content in mol% of DNA is the proportion of guanine and cytosine with respect to the total…
Q: 9) These bacteria in the picture to the left are called Staphyl why is it called Staphylococcus.
A: Bacteria will be found as single-celled organisms, in pairs, and in teams. Microorganisms are…
Q: Salmonella typhi Cyanobacteria Jame of Anabaena spiroides nicroorganism Genus species) Morphology…
A: Salmonella Typhi (S. Typhi) are bacteria that infect the intestinal tract and the blood. they are…
Q: Explain the different role, association and impact of Lactobacilli in food microbiology that you…
A: Lactobacillus is a bacteria belonging to the genus of Gram-positive, facultative anaerobic or…
Q: Lactic Acid Bacteria (LAB) is commonly used in the conversion of milk into curd. Mention any two…
A: Bacteria are a group of prokaryotic microscopic single celled organisms. They live in diverse…
Q: You have undergone the different characteristics. List 10 bacteria. Supply their characteristics…
A: Bacteria are unicellular prokaryotic structures. The cells are devoid of a true nucleus, that is the…
Q: Which of the following reports bacteria counts as colony-forming units? Turbidity Most probable…
A: Bacteria are microscopic unicellular organisms that can be grown in culture for the benefit of the…
Q: Which of the following is not a classification of bacteria? Bacillus Spirilla Barilla Cocci
A: Bacteria belongs to prokaryotes.i.e they do not have membrane enveloped nucleus and membrane bound…
Q: ENDOSYMBIOTIC THEORY application to this subject (BIOCHEMISTRY)?
A: It is believed that life arrived on earth some four billion years ago and the first cells were…
Q: The subunit of capsid is called (a) core (b) nucleotide (c) amino acid (d) capsomere
A: A virus is a very small submicroscopic agent that is known for causing infections in its host…
Q: Aeromonas Salmonicida classification; genotypic and phenotypic information; where it lives; its…
A: Aeromonas salmonicida classification and other information.
Q: i) Idealize the three-dimensional structure of the bacillus using spheres and a 3D rectangle. Draw…
A: It is well known that bacteria and cells are found to exist in various shapes and sizes. There are…
Q: 8. Explain about Microbial taxonomy?
A: Microorganisms can be categorised through the use of microbial taxonomy. Organisms that fit into the…
Bacteri & fungi microbe structure and composition of genetic material.
Step by step
Solved in 2 steps
- Difference between Capsule and Microcapsule in bacteria.Lysogenic Cycle Domain Anaerobic Cellulose Species Heterotroph Conjugation. Gram Positive Chitin 1. An organism that cannot make it's own food and must find food in it's environment. 2. What cell membranes of fungi cells are made of. 3. Viral reproduction where DNA is injected into the host and becomes a part of the host chromosome. 4. Indicates that peptidoglycan is present in the cell wall. 5. Does not require oxygen. 6. Sexual Reproduction in Bacteria. 7. Most general taxa. 8. Most specific taxa. 9. None of the above Please match the following"Biodegradation of Diesel Oil Using Bacillus Isolates" Environmental pollution is now a worldwide burning issue. There are many places in the Philippines, which are now contaminated by petrochemical sources, such as petroleum refineries and storage sites, paint manufacturing plants, gasoline service stations, gas emissions, etc. (EMB-DENR, 1997). Although the basic solution to the pollution problem is the elimination of the sources of these pollutants, there are however overriding economic, social and political factors that must be considered. An attractive remedial measure is the use of pesticide-degrading microorganisms for the environmental clean-up. Bacteria of the genus Bacillus are a group of versatile microbes known to degrade complex organic matters refractive to most microorganisms. Several species produce enzymes that catalyze the breakdown of petroleum products in water as well as in oil. These bacteria may provide the means of eliminating unwanted pollutants in the…
- Naming and Classifying Microorganisms 1. Recognize the system of scientific nomenclature that uses two names: a genus and a specific epithet. 2. Differentiate the major characteristics of each group of microorganisms. 3. List the three domains. A Brief History of Microbiology 1. List at least four beneficial activities of microorganisms. 2. Name two examples of biotechnology that use recombinant DNA technology and two examples that do not. 3. Explain the importance of observations made by Hooke and van Leeuwenhoek. 4. Compare spontaneous generation and biogenesis. 5. Identify the contributions to microbiology made by Needham, Spallanzani, Virchow, and Pasteur. 6. Define bacteriology, mycology, parasitology, immunology, and virology. 7. Explain the importance of microbial genetics and molecular biology.8. Pigment or color (e.g.: opaque, translucid, red, yellow, rose, violet, etc..) is also another characteristic that can be used to identify your microorganism in a slant Thus, write down the name of three microorganisms (using scientific notation: Escherichia coli) that present a pigmented pattern of growth in a slant (write down the color of each pigment) and the name of the disease that they may cause. F10 F12 F6 %24 6. R. Home Enter K F G A Shift C Page Up Page Down Alt Ctrl Alt ΣColony Morphology on TSA Plate ColoniesSize,Color, ElevationS. saprophyticus and S. marcescens
- of bacteria. The Gram stain works because of differences in the O 1) cell membranes O 2) genetic characteristics O 3) capsules O 4) antigens O 5) cell wallsDevelopment of Resistance to antimicrobial drugs: What is the difference between a natural, semisynthetic, and synthetic antibiotic? How was the first natural antibiotic discovered? (To answer this question, identify the antibiotic, distinguish between the fungus and the antibiotic, explain where the antibiotic came from, and explain how people knew the antibiotic had antibiotic properties.) Give an example of a strain of bacteria (Genus and species) that is now resistant to commonly used antibiotics (identify the specific antibiotic). Describe the physiological mechanism used by individual bacteria to resist the antibiotic listed in part “3” of this Thought Question. For example, the mechanism could be modification of drug, modification of target, prevention of drug penetration, overproduction of target, or target mimicry. (This means that you must choose a strain of bacteria that we know the characteristic of the bacteria that allows the bacteria to be resistant.) How do…You grow this weird looking organism in lab and have no idea what it is. You decide to sequence its genome and one of the reads you get back is shown below: >UnknownSequence1 GCGGTATTTGACGCCGCATTCGAAGTGGTCGATCCATTCGGCGTATCAGGACAATTTGCATATGTTGACGTTGTCGCGGGGTGGGCCCTCGATCTGGATGTCGGAGCGGGACGCGGC GAAGATCGGTGTGGCCGATAATGATTGGATCGAGGCGGTCAATCGTAACGGGGTGGTGGTGGCGCGGGCGATCGTGT
- what is plaque essay? what is the purpose of this lab? why this lab is perform? (bacteriophage) what techniques is used and how can we derive information(data)? methologies, theory, mechanism for reactions that lead to observable results. required information on microbial metabolism. why is the microbe doing this?The anaerobic Clostridium species are troublesome pathogens largely because of their capacity for biofilm production. rapid reproduction. high salt tolerance. endospore production. oxygen production.● ● Differentiate anaerobes from aerobes and describe how they are cultured. Explain how both aerobes and anaerobes can cause disease. Discuss how biofilms develop. Explain the importance of biofilms to infection. Describe the process of sporulation, and explain how spores impact certain infections.