An RNA produced from a fragment of DNA has the sequence of 5'AAUUGGCU3'. The sequence of the nontemplate strand in the DNA that gives rise to this sequence should be All sequences below are written in 5'→3'. A. AGCCAATT B. AAUUGGCU C. AATTGGCT D. TTAACCGA E. UUAACCGA
Q: 2) a. Give the name of the following glycoside: но. он но но b. Draw the structure of the…
A: In the question 2a, the compound has D-mannose sugar linked to a phenyl ring with O-glycosidic bond…
Q: Given ohationg im which is a Jlist of orgamelles ņ mitochondira, endopla smic rediculerm,pesoxisomes…
A: A cell is composed of a cell membrane, cytoplasm, and cellular organelles in the cytoplasm.…
Q: In a glucometer, glucose oxidase catalyzes the redox reaction of glucose to form gluconolactone.…
A: A glucometer is generally a little, portable device that helps to monitor (glucose levels) at home.…
Q: Begining with 1 M concentrations of each reactant and product at pH=7 and 25.0 degrees C, calculate…
A: The reaction given in the problem is the reaction between Pyruvate to Lactate conversion which is…
Q: Show the amount of ATP were produced in beta-oxidation of lauric acid, and differentiate both the…
A: Lauric acid has a 12-carbon backbone and is a saturated medium-chain fatty acid. Under anaerobic and…
Q: Can someone please draw out phosphorylated creatine?
A:
Q: Describe how you would make 10mls of a solution with concentration: 10mM Glucose (MW-180.16g/mole)…
A: In a solution concentration of solute is reduced simply by mixing more water or by adding more…
Q: 1. Why a peptide bond can't rotate freely? 6%. 2. The and are two amino acids usually will break an…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: 18:1c∆9 ω-9 fatty acid oleic acid both are correct neither is correct
A: In plants, animals, and microbes, fatty acid is a key component of lipids (fat-soluble components of…
Q: How can human females and males function normally, despite carrying different umbers of the X…
A: Each persons normally has one pair of sex chromosomes in each cell. Females express two X chrmosome…
Q: rilling fatty meats over glowing charcoal produces a volatile, pungent chemical which causes…
A: Introduction: A chemical reaction is a process of breaking chemical bonds in one or more substances…
Q: Acetyt CoA Oxaloscetate CoA NADH Citrate NAD Isocitrate Malste Pumarate NAD NADH FADH, FAD a-…
A: TCA cycle is the tricarboxylic acid cycle which is second step in cellular respiration that occurs…
Q: Aspartic acid has a side chain bearing a carboxylic acid group; its pKą is ~4. The alpha-carboxylic…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: Only one of the statements below is correct; which one? Two solutions are hypotonic when they have…
A: Here, four statements are given based on osmotic pressure and we have to find out the correct…
Q: 2. Glvcolate is oxidized into Glvoxylate by cytochrome Cusing the glycolate oxidase enzyme, The two…
A: Glycolate oxidase is a key enzyme involved in the conversion of glycolate to glyoxylate during…
Q: If the extracellular K* concentration increases to 20 mM, what would be the Nernst Potential of K*…
A: Membrane potential is the voltage difference between inside to outside of the cell. In absence of…
Q: Explain the enzymes.
A: Enzyme, a molecule that works as a catalyst in living organisms, regulating the pace at which…
Q: What carbohydrate is generally detected using the Molisch test? *
A: Carbohydrates are polyhydroxy aldehydes or ketones commonly called as sugars or saccharides.…
Q: TBP is a eukaryotic DNA binding protein that specifically recognizes the Pribnow box. True False
A: Introduction: The TATA box binding protein provides instructions for making a protein called TATA…
Q: The molecules of a fatty acid (for example, fit closer together than the molecules of a fatty acid…
A: Fatty acids are composed of a long hydrocarbon chain attached to a carboxylic acid group. Fatty…
Q: III. Effect of inhibitor Color of bromothymol blue indicator Test Tube Original color Final color A…
A: Bromothymol blue is a pH indicator that commonly turns yellow in acidic solution and turns blue in…
Q: In electron transport c Select one: О a. 1 АТР O b. 2ATP Ос. ЗАТР O d. None of the abe
A: Metabolism includes biosynthesis/ reduction (an anabolic process) and oxidation (catabolic…
Q: The picture below shows the body's response to acute stress, which is to release adrenaline…
A: Introduction: Adrenergic neurons release norepinephrine as the primary neurotransmitter. These…
Q: All are members of the electron transport chain, except: Select one: O a. iron-sulfur center O b.…
A: The components of the Electron Transport Chain (ETC) are found in the mitochondria. During…
Q: What is another name for the glycolate pathway?
A: The process of respiration that is initiated in the chloroplast and take place only during day is…
Q: Using the concept of complementary base pairing, write the complementary DNA strands, with their 5'…
A: The DNA molecule generally has two strands that wind around one another to form a shape is generally…
Q: Which of the following is NOT a primary method used to regulate the activity of cyclin-dependent…
A: Cyclin-dependent kinases (CDKs) are the protein kinases which plays a role in regulating the cell…
Q: Both reducing monosaccharide and disaccharide give positive result in Barfoed's test. Which of the…
A: Barfoed's test is done to differentiate between monosaccharide and disaccharide.
Q: Enzymatic digestion of carbohydrates starts in the mouth. True False
A: Enzymatic digestion is generally referred to as the act of breaking down ingested food materials,…
Q: In the 1step of the 2-step reaction shown below, which substrate/co-substrate is being oxidized?…
A: The above reaction is a part of beta oxidation of fatty acid process.
Q: The questions ask you to identify which compounds have a specific functional group. For each…
A: Here all the compounds given are organic compounds with Carbon and hydrogen back bone structure. It…
Q: Design the simple process scheme diagram for (fermentation and recovery of glutamic acid from palm…
A: The breakdown of carbohydrate under anaerobic condition is referred to as fermentation. In…
Q: Calculate the standard free-energy change, deltaG°, for the reaction in which acetaldehyde is…
A: Standard free energy of biochemical reaction is related to standard reduction potential ∆Go = -nFEo…
Q: QUESTION; — Compare and contrast the degradation pathways of purines and pyrimidines, making sure to…
A: Nucleotides are used in nucleic acid synthesis, intermediate metabolic processes, and the breakdown…
Q: Gold nanoparticles are applied in cancer therapy; approaches such as photothermal therapy as well as…
A: Photothermal therapy is the process of using electro magnetic radiation for treatment of cancer.…
Q: Please discuss how digitoxin provides a positive inotropic effect and is used to treat congestive…
A: Digitoxin is a cardiac glycoside that is used in the treatment of heart failure. Glycoside are…
Q: Paracelsus is famous for saying that “all substances are poisons; there is none which is not a…
A: Poisons are chemicals that have the potential to kill. They are chemicals, either man-made or…
Q: Which of the following statements regarding the structure of DNA inside cells is NOT correct? A.…
A: DNA : Double helix A: Adenine G: Guanine T: Thymine C : Cytosine
Q: Match lipid structures in column A with its lipid type in column B esters of fatty acids with long…
A: The question include match the following with different options. The correct options are mentioned…
Q: estion properly and accordingl
A: Saponification is the process of forming a metallic salt of a fatty acid, which is referred to as a…
Q: Question 8 O alpa-palmitoyl-beta-stearoyl-alpha-oleoyl glycerol O…
A: Triacylglycerols (TAGs) are the stored form of lipids, which are composed of three fatty acids and a…
Q: Which of the following contain copper atoms (Cu2*) Select one: O a. Complex II O b. Complex III…
A: There are four enzyme complexes of ETC present in the inner mitochondrial membrane. Complex 1-…
Q: CHALLENGE QUESTION I: Smurf hemoglobin has a p50 of 30 torr and has 8 subunits, instead of the usual…
A: Fractional saturation(Y) is the ratio of concentration of protein-ligand complex to total…
Q: Please explain where you would find glycosaminoglycans and what is the importance of these…
A: GAGs are negatively charged linear polysaccharides that are frequently found conjugated with…
Q: Explain under what conditions "substrate concentration" is the limiting factor for enzymatic…
A: Enzyme and substrate bind each other form E-S complex which decomposes to give product. Substrate…
Q: Eukaryotic RNAs, such as tRNA and rRNA use different RNA Polymerases. True False
A: Eukaryotic transcription:- In Eukaryotes, 3 different kind of RNA polymerase are used.
Q: In plants, under what solution conditions are Calvin cycle and gluconeogenesis enzymes most active?…
A: Gluconeogenesis is the process of Synthesis of glucose from non Carbohydrate sources like aminoacids…
Q: . What mRNA base sequence would be obtained from the following portion of a gene?
A: Genetic information is transferred from genes to the proteins via messenger RNA.…
Q: Question 17 In a glucometer, glucose oxidase catalyzes the redox reaction of glucose to form…
A: Glucometer is the instrument used to measure and display the amount of glucose level in the blood.…
Q: Lysine is similar to ornithine. .Why does lysine not form a lactam? a. Infrequency of lysine…
A: A lactam is a cyclic amide (lactone+amide). A lactam antibiotic is an antibiotic that contains a…
Step by step
Solved in 3 steps
- Which of the following sequences on a DNA molecule would be complementary to GCTTATAT? TAGGCGCG ATCCGCGC CGAATATA TGCCTCTC1. what will be the mRNA complimentary strand of a DNA sequence AATCGGCTGGGATTA? a. UUAGCCGACCCUAAU b. AAUCGGCUGGGAUUA c. TTAGCCGACCCTAAT d. UUTCGGCTGGGUTTU 2. what will be the amino acid sequence of DNA with a sequence AATCGGCTGGGATTA? a. leucine - alanine - aspartic acid - serine - aspagarine b. leucine - threonine - aspartic acid - serine - aspagarine c. leucine - alanine - aspartic acid - proline - aspagarine d. tyrosine - alanine - aspartic acid - proline - aspartic acid 3. what type of points mutation happened if the mutated DNA sequence is TTA-CAG-CAG-GGT-GGC? a. addition b. deletion c. insertion d. subtitution 4. if the first nitrogenous base "T" will be replaced by "G" ; what will be the resulting amino acid for the first codon? a. isoleucine b. leucine c. tyrosine d. trytophan 5. what type of point mutation happened if the mutated DNA sequence is TTS-CGC-AGG-GTG-GC? a. addition b. deletion c. insertion d. substitution2. Refer to the protein phe-trp-tyr-cys-ala-met-leu, construct a DNA strand that can transcript an mRNA and tRNA that can produced that proteina. mRNA strandb. tRNA strandc. DNA strand (5’-3’)d. DNA strand (3’-5’)
- 8. For the double strand DNA molecule below, assume the 3' DNA strand acts as the template for creating the MRNA. Write the corresponding MRNA 5' 1 3' and translate this mRNA into protein. DNA 3' CGTGAATACGCTACGGAACTCACTGGTA 5' DNA 5' GGCACTTATGCGATGCCTTGAGTGACCAT 3' MRNA 5' Protein UCAGUCAG UCPG Alanine GU U/c GU A Tyrosine C Stop A G Cysteine Valine G A Stop G Tryptophan Arginine A G AC A C UG ACUGACU C Leucine Serine G C A Lysine Proline Asparagine Glycine alanine Leucine Phenyl- Serine Glutamic acid Aspartic acid Histidine Glutamine Threonine1. Written below is a DNA seqeunce: G G C A A C T A T C C C G A T T A G C G C Write down the sequence for the complimentary DNA sequence 2. Written below is the DNA sequence of a gene: T A C C T A A G C G C C G G T C A T A T C A. Write down the mRNA sequence that would be transcribed from this DNA B. Write down the amino acid sequence that would be translated from the mRNA sequence 3. Written below is the DNA sequence of a gene: T A C G T G T T T A C T C C A C A T G A T A T C A. Write down the mRNA sequence that would be transcribed from this DNA B. Write down the amino acid sequence that would be translated from the mRNA sequence1. Given the piece of MRNA: 5'-CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCC-3' 1. Predict the DNA strand sequence from which it was transcribe 2. List the complementary non-coding DNA Sequence 3. List the Amino acid Sequence of the protein coded for. Use the Genetic Code 2. Below is a short segment of a DNA molecule. Translate the DNA codon into MRNA. 5'- TACCATGAGAATTGTGG TCACCTTTTT-3' 3'- ATGGTACTCTTAACACCAGTGGAAAA A-5' MRNA Sequence Amino Acid Sequence
- 6. Examine the following coding strand DNA nucleotide sequence,^representing the complete gene sequence (i.e. control elements + RNA-coding sequence) of a bacterial gene. Answer the questions below by using the list of consensus sequences and the genetic code. 5' CGCTCAGAAAATTATATTAAATTTCCTCTTGACACTCGCTTTCGTGATCGTCTTATAATGTGTGGATG CCGAAAACGACAATTTCTGACTTACCGGGGTTTTAAGGAGGTAATATGCAAATTAGCGATACCGGCC GCAGCCACACTCCTGACTTTCACGCCTAGTCGCCCGTGAAGACTGGCACAACCAGACCATTACCCACC TTAACCGCCTGCCAGCGCATCCCGTTTTCGCCAGCTGGCGCGATGAGCTTGCCGCCCGCGATTCAGCC CGCGTAGTAAGCGGGCTTTTTTTGGGAGTGGCAGTTCTCTTACGCCCGCAGCCCG 3' Clearly indicate the following directly on the DNA sequence above: promoter elements - underline and label as (a). the sites for initiation of transcription - use an arrow V and label as (b). the sites for termination of transcription – use an V arrow and label as (c). d. Give the sequence of the first 10 nucleotides of the mRNA transcript 5' to 3'. a. b. С.8. For the double strand DNA molecule below, assume the 3' DNA strand acts as the template for creating the mRNA. Write the corresponding mRNA 5' 3' and translate this mRNA into protein. DNA 3' CCGTGAATACGCTACGGAACTCACTGGTA 5' DNA 5' GGCACTTATGCGATGCCTTGAGTGACCAT 3' mRNA 5' Protein Aline Valine Arginine partic Lysine Asparagine COTOCOAQUC. C FOU U G A Glycine Threonine A GUC A GU G Stop Step Cysteine GTryptophan Phenyl- sarine Lauche C Serie CROUCH UG A C U Hatidine Tyrosine 2060 20/ Leucine Proine3. DNA: TACGGGCCTATACGCTACTACT CA TG GATCGG MRNA: UC Codon: Anitcodon: Amino Acids: 4. DNA: G T ACGCGTATACCGACATTC MRNA: Codon: Anitcodon: Amino Acids: A8m Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain, identifying the codons, anticodons, and amino acid sequence. DNA: CGAT ACAATGGACCCGGTATGCGATATCC DATAA
- 8. You have a piece of DNA with the sequence shown below. 5-AAAGTCGCTGGAATTCACTGCATCCCCGGGGCTATATATGAATTCGATGCGTACTTGGCACG-3' 3'TTTCAGCGACCTTAAGTGACGTAGGGGCCCCGATATATACTTAAGCTACGCATGAACCGTGC-5' You cut this fragment with the restriction enzyme EcoRI. The recognition site for EcoRI is 5-GAATTC-3' 3-CTTAAGS" EcoRI cuts at the site and in the manner indicated by the arrows to yield fragments with overhanging ends. 3-СТТААG-5' 5'G AATTC-3' 3-СТТАА G-5' Draw an illustration showing how the piece of DNA is cut by EcoRI and how many fragments result. Show all the base pairs and the overhanging ends at the ends of the DNA fragments.2. a. Below is a portion of a bacterial chromosome that contains a gene. The promoter region and the +1 base pair are indicated, as well as the direction (5' and 3') of the two DNA strands. +1 -10 -35 3'тTGCATССGAAАCGTACGATCGATCGGCCGACTТАТТАСGАТСGGACTAфTGCGTCсTAGC5'... ...5'AACGTAGGCTTTGCATGCTAGCTAGCCGGCTGAATAATGCTAGCCTGATGACGCAGCATCG3'... (i) Write the first 12 nucleotides of the RNA molecule transcribed from this gene. Be sure to indicate the 5' and 3' ends from left to right of the RNA strand. (ii) Explain why the Start codon does not appear in the first three nucleotides of the sequence transcribed in (i).25. Given the following mRNA codons and amino acids, construct a polypeptide from this DNA strand. DNA AAT GGT CCA CCG CTG 1TI 111 11 T Ou GGT GGC GIC MRNA Amino Acids UUA = leucine %3D GAC = asparginine GGU = glycine GGC = glycine CCA = proline %3D AMAM b iwi tant neto10 e 2obitoabun St