Homework Help is Here – Start Your Trial Now!
Science
Biology
Among all these primer pairs from Primer-Blast, which is the best to use for a PCR reaction and why?

Among all these primer pairs from Primer-Blast, which is the best to use for a PCR reaction and why?

Human Anatomy & Physiology (11th Edition)
Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:Elaine N. Marieb, Katja N. Hoehn
Chapter1: The Human Body: An Orientation
Section: Chapter Questions
Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...
See similar textbooks
icon
Related questions
icon
Concept explainers
Question

Among all these primer pairs from Primer-Blast, which is the best to use for a PCR reaction and why?

Primer pair 7 Sequence (5'->3') Template strand Length Start Stop Tm GC% Self complementarity Self 3' complementarity Forward primer Reverse primer Product length AAGGAACGGCACGGATGATT Plus 20 392 411 60.04 50.00 3.00 1.00 TGGTCGAACCAGTCAGCCAA Minus 20 1391 1372 61.69 55.00 6.00 1.00 1000 Primer pair 8 Sequence (5'->3') Template strand Length Start Stop Tm GC% Self complementarity Self 3' complementarity Forward primer Reverse primer Product length CGCGCTACAGGATTTTTCAGG Plus 21 223 243 59.94 52.38 4.00 0.00 GCCATCCGACАСAATТCССА Minus 20 1222 1203 60.68 55.00 4.00 0.00 1000 Primer pair 9 Sequence (5'->3') Template strand Length Start Stop Tm GC% Self complementarity Self 3' complementarity Forward primer Reverse primer Product length ATGGATCGAAGGAACGGCAC Plus 20 384 403 60.46 55.00 4.00 0.00 CCAGTCAGCCAAACGATAAGC Minus 1383 1363 59.60 52.38 2.00 2.00 1000 Primer pair 10 Sequence (5'->3') Template strand Length Start Stop Tm GC% Self complementarity Self 3' complementarity Forward primer Reverse primer Product length GCGCTACAGGATTTTTCAGGG Plus 21 224 244 59.60 52.38 4.00 0.00 TGCCATCCGACACAATTCCC Minus 20 1223 1204 60.68 55.00 4.00 0.00 1000 21
Transcribed Image Text:Primer pair 7 Sequence (5'->3') Template strand Length Start Stop Tm GC% Self complementarity Self 3' complementarity Forward primer Reverse primer Product length AAGGAACGGCACGGATGATT Plus 20 392 411 60.04 50.00 3.00 1.00 TGGTCGAACCAGTCAGCCAA Minus 20 1391 1372 61.69 55.00 6.00 1.00 1000 Primer pair 8 Sequence (5'->3') Template strand Length Start Stop Tm GC% Self complementarity Self 3' complementarity Forward primer Reverse primer Product length CGCGCTACAGGATTTTTCAGG Plus 21 223 243 59.94 52.38 4.00 0.00 GCCATCCGACАСAATТCССА Minus 20 1222 1203 60.68 55.00 4.00 0.00 1000 Primer pair 9 Sequence (5'->3') Template strand Length Start Stop Tm GC% Self complementarity Self 3' complementarity Forward primer Reverse primer Product length ATGGATCGAAGGAACGGCAC Plus 20 384 403 60.46 55.00 4.00 0.00 CCAGTCAGCCAAACGATAAGC Minus 1383 1363 59.60 52.38 2.00 2.00 1000 Primer pair 10 Sequence (5'->3') Template strand Length Start Stop Tm GC% Self complementarity Self 3' complementarity Forward primer Reverse primer Product length GCGCTACAGGATTTTTCAGGG Plus 21 224 244 59.60 52.38 4.00 0.00 TGCCATCCGACACAATTCCC Minus 20 1223 1204 60.68 55.00 4.00 0.00 1000 21
Primer pair 1 Sequence (5'->3') Template strand Length Start Stop Tm GC% Self complementarity Self 3' complementarity Forward primer Reverse primer Product length AATGGATCGAAGGAACGGCA Plus 20 383 402 59.75 50.00 4.00 0.00 CAGTCAGCCAAACGATAAGCG Minus 21 1382 1362 59.94 52.38 3.00 3.00 1000 Primer pair 2 Sequence (5'->3') Template strand Length Start Stop Tm GC% Self complementarity Self 3' complementarity Forward primer Reverse primer Product length ATTTAAGGTCGCTGCCCGTC Plus 20 69 88 60.74 55.00 4.00 1.00 AGGTTTTTGAGCCCATTCGC Minus 20 1068 1049 59.40 50.00 4.00 2.00 1000 Primer pair 3 Sequence (5'->3') Template strand Length Start Stop Tm GC% Self complementarity Self 3' complementarity Forward primer Reverse primer Product length CATTTAAGGTCGCTGCCCGT Plus 20 68 87 61.02 55.00 4.00 2.00 GGTTTTTGAGCCCATTCGCC Minus 20 1067 1048 60.39 55.00 4.00 1.00 1000 Primer pair 4 Sequence (5'->3') Template strand Length Start Stop Tm GC% Self complementarity Self 3' complementarity Forward primer Reverse primer Product length ACATTTAAGGTCGCTGCCCG Plus 20 67 86 61.02 55.00 5.00 2.00 GTTTTTGAGCCCATTCGCCC Minus 20 1066 1047 60.39 55.00 4.00 2.00 1000 Primer pair 5 Sequence (5'->3') Template strand Length Start Stop Tm GC% Self complementarity Self 3' complementarity Forward primer Reverse primer Product length ACCCCAGTTTGGTTATGCCC Plus 20 39 58 60.25 55.00 3.00 2.00 САTGGTCTTCТСАСТСGGTGT Minus 21 1038 1018 59.73 52.38 4.00 3.00 1000 Primer pair 6 Sequence (5'->3') Template strand Length Start Stop Tm GC% Self complementarity Self 3' complementarity Forward primer Reverse primer Product length AGGAACGGCACGGATGATTC Plus 20 393 412 60.46 55.00 3.00 3.00 TTGGTCGAACCAGTCAGCC Minus 19 1392 1374 59.93 57.89 6.00 1.00 1000
Transcribed Image Text:Primer pair 1 Sequence (5'->3') Template strand Length Start Stop Tm GC% Self complementarity Self 3' complementarity Forward primer Reverse primer Product length AATGGATCGAAGGAACGGCA Plus 20 383 402 59.75 50.00 4.00 0.00 CAGTCAGCCAAACGATAAGCG Minus 21 1382 1362 59.94 52.38 3.00 3.00 1000 Primer pair 2 Sequence (5'->3') Template strand Length Start Stop Tm GC% Self complementarity Self 3' complementarity Forward primer Reverse primer Product length ATTTAAGGTCGCTGCCCGTC Plus 20 69 88 60.74 55.00 4.00 1.00 AGGTTTTTGAGCCCATTCGC Minus 20 1068 1049 59.40 50.00 4.00 2.00 1000 Primer pair 3 Sequence (5'->3') Template strand Length Start Stop Tm GC% Self complementarity Self 3' complementarity Forward primer Reverse primer Product length CATTTAAGGTCGCTGCCCGT Plus 20 68 87 61.02 55.00 4.00 2.00 GGTTTTTGAGCCCATTCGCC Minus 20 1067 1048 60.39 55.00 4.00 1.00 1000 Primer pair 4 Sequence (5'->3') Template strand Length Start Stop Tm GC% Self complementarity Self 3' complementarity Forward primer Reverse primer Product length ACATTTAAGGTCGCTGCCCG Plus 20 67 86 61.02 55.00 5.00 2.00 GTTTTTGAGCCCATTCGCCC Minus 20 1066 1047 60.39 55.00 4.00 2.00 1000 Primer pair 5 Sequence (5'->3') Template strand Length Start Stop Tm GC% Self complementarity Self 3' complementarity Forward primer Reverse primer Product length ACCCCAGTTTGGTTATGCCC Plus 20 39 58 60.25 55.00 3.00 2.00 САTGGTCTTCТСАСТСGGTGT Minus 21 1038 1018 59.73 52.38 4.00 3.00 1000 Primer pair 6 Sequence (5'->3') Template strand Length Start Stop Tm GC% Self complementarity Self 3' complementarity Forward primer Reverse primer Product length AGGAACGGCACGGATGATTC Plus 20 393 412 60.46 55.00 3.00 3.00 TTGGTCGAACCAGTCAGCC Minus 19 1392 1374 59.93 57.89 6.00 1.00 1000
Expert Solution
steps

Step by step

Solved in 5 steps

SEE SOLUTIONCheck out a sample Q&A here
Blurred answer
Knowledge Booster
Molecular techniques
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
  • SEE MORE QUESTIONS
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:
9780134580999
Author:
Elaine N. Marieb, Katja N. Hoehn
Publisher:
PEARSON
Biology 2e
Biology 2e
Biology
ISBN:
9781947172517
Author:
Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:
OpenStax
Anatomy & Physiology
Anatomy & Physiology
Biology
ISBN:
9781259398629
Author:
McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:
Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:
9780815344322
Author:
Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:
W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:
9781260159363
Author:
Martin, Terry R., Prentice-craver, Cynthia
Publisher:
McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Inquiry Into Life (16th Edition)
Biology
ISBN:
9781260231700
Author:
Sylvia S. Mader, Michael Windelspecht
Publisher:
McGraw Hill Education
SEE MORE TEXTBOOKS