All cells of the body, with a few exceptions, contain the same genome. What is the name of the regulation of genes in response to the environment? Briefly describe two ways in which this can occur.
Q: What process in mRNA folding leads to sensitivity to pain due to an effect on the COMT gene?
A: COMT is catechol-o- methyltransferase protein presence required for pain sensitivity.
Q: At which level of gene regulation shown in Figure 16.1 does attenuation occur?
A: Genes are the basic structural and functional unit of heredity. They carry coded genetic information…
Q: Which natural genetic mechanism is responsible for preventing the expression of genes that are…
A: DNA is made up of numerous molecules known as nucleotide. A non-sense mutation is a type of mutation…
Q: List factors influencing epigenetic tags. What can the resulting epigenetic changes lead to? Provide…
A: Epigenetics is the study of how the behaviors and environment can cause changes that affect the way…
Q: In the regulatory switch experiment, which level of gene expression regulation is the focus?…
A: Gen regulation is the method in which there are found different components which are involve in…
Q: My textbook says:"Protein encoding genes control protein production indirectly, using a related…
A: Proteins are made of structural building blocks called as amino acids and are found in all cells and…
Q: List and briefly describe five types of molecular mechanisms thatmay underlie epigenetic gene…
A: A gene is a stretch of nucleotides present in the DNA. DNA or deoxyribonucleic acid is a polymer of…
Q: What mechanisms are thought to be responsible for the inheritance of epigenetic information?
A: Epigenetics refers to the study of the stable heritable changes which takes place in the genome of…
Q: Epigenetics may be involved in the finetuning of gene expression. How might thisaffect the behavior…
A: Epigenetics is the study of heritable phenotype changes that do not involve alterations in the DNA…
Q: Why is the GTPase activity of G proteins crucial to the proper functioning of a cell? Why have G…
A: GTPass activities are performed by the GTPases which are the families of hydrolase enzymes. G…
Q: Although each cell in your body contains the same set of genes, the genes that are “turned on”…
A: Genes are the sequence of nucleotide found on our DNA which is capable of undergoing transciption…
Q: What is epigenetics and what are the three major epigenetic modification mechanisms?
A: Epigenetics is the investigation of heritable changes in gene expression which don't include changes…
Q: What is the purpose of CAP and CAMP in gene regulation?
A: A wide range of mechanism carried out by the cells that act to induce or repress the synthesis of…
Q: What are the main epigenetics mechanisms
A: Epigenetics is branch of science which determine how gene expression is reshaped without changing…
Q: Describe and give an example of each of the following levels of gene expression control in…
A: Genes are a set of nucleotides sequence that carries information to be passed on from one generation…
Q: In order to manufacture insulin for patients with diabetes, scientists create recombinant DNA by…
A: The insertion of normal gene into the genetic material of any organisms like common bacteria are…
Q: How do we know that expression of the information encoded in DNA involves an RNA intermediate?
A: The genetic material of the cell, that is, the DNA (deoxyribonucleic acid) comprises various genes…
Q: The molecular mechanisms that underlie epigenetics include which of the following? (select all that…
A: The expression of genes can be controlled by different mechanisms. The epigenetic modification is…
Q: Using coat color in mice and the development of female honeybees as examples, explain how dietary…
A: Epigenetics is a state of gene expression where there are no changes in the DNA sequence but the…
Q: Epigenetic markers tell your genes to switch on or off. What are two environmental factors that can…
A: While most environmental exposures affect somatic cells and do not allow for transgenerational…
Q: What do you predict would be the consequence of a mutation in FtsZ that disrupts the function of the…
A: FtsZ is a protein found in the prokaryotes as well as some eukaryotes which are encoded by the ftsZ…
Q: Protein levels and mRNA levels for a particualr gene don’t always match. For example, the GCN4 gene…
A: Protein level and mRNA level for a particular gene do not always match because proteins are only…
Q: Base on your knowledge of DNA, chromosomes and epigenetics and upon examining the picture below,…
A: Epigenetic modification is the changes in chromatin structure which can result in repression or…
Q: Which of the following is not a possible outcome of changing the epigenetic code? a) exposure of…
A: * Epigenetic code is an defining code in eukaryotic cells in which each cell consist specific…
Q: Give an example of an epigenetic effect of diet on metabolism.
A: Epigenetics is the study involving the study of heritable changes that occur in gene expression…
Q: Which of the following statements about the differential expression of human genes is correct?
A: There are three postulates of differential gene expression, two of which states that - 1. Every…
Q: What areas of the brain do you think are affected when there is a decreased expression of ERα mRNA…
A: * The estradiol is the harmone which will do protection actions. *This will help effects the long…
Q: What evidence suggests that cognition in mice is influenced by epigenetic changes?
A: Epigenetic effects are the effects due to the heritable changes in the gene function and are not the…
Q: What is dominant control mechanism of gene expression? explain the following image.
A: Dominant alludes to a connection between two adaptations of a gene. In case one is dominant, the…
Q: Which of the following is NOT a description of an epigenetic modification? A. regulatory patterns…
A: Changes in gene expression that are not produced by changes in DNA sequences but are caused by…
Q: Which of the following is NOT a description of an epigenetic modification? -The persistence of gene…
A: ANSWER;- Regulatory patterns that persist in the absence of the original signal. It is NOT a…
Q: a hormone receptor gene is deleted from the genome of a cell.in the absence of the hormone,what…
A: A hormone receptor is a receptor molecule that binds to a specific hormone. These receptors could be…
Q: Protein levels and mRNA levels for a particualr gene don’t always match. For example, the GCN4 gene…
A: Gene expression techniques such as PCR (polymerase chain reaction), microarrays and some assays such…
Q: How would a DNA codon sequence influence the shape and the expression of the allele
A: Hello. Since your question has multiple parts, we will solve the first question for you. If you want…
Q: Which of the following processes is an example of an epigenetic effect (meaning not originating in…
A: Genes are very much crucial in regulating the health of the body and behavior of an individual which…
Q: Which of the following is not a major mechanism of epigenetic change? a. DNA methylation b.…
A: Deoxyribonucleic acid (DNA) is a double-stranded molecule. DNA replication is the process by which…
Q: Two component systems are common in bacteria to regulate the expression of specific genes in…
A: According to the question, Two-component systems are common in bacteria to regulate the expression…
Q: The study of Epigenetics includes which of the following? (Choose all that apply)
A: 1.The vertical transmission of histone modifications 3.How Histone acetylation affects gene…
Q: Give two examples of how gene expression may be repressed without altering the coding sequence.
A: Epigenetics is the study of how our behaviors and environment affect the way our genes work.
Q: Which one of the following describes an epigenetic modification? O A point mutation in the coding…
A: A methyl group bound to DNA inhibit transcription of gene. This sentence denotes an epigenetic…
Q: eritable effects of gene expression that are not caused by a change in DNA sequence are called…
A: EPIGENETIC CHANGES are heritable changes in gene expression that do not involve changes to the…
Q: The required association of two α-globin molecules and two β-globin molecules to make a functionally…
A: The regulation of gene expression occurs at the transcription, translation and chromatin regulation…
Q: What is meant by the differential activation of genes? Explain how this affects the synthesis of…
A: Genes are the basic structural and functional units of heredity. They play a major role in carrying…
Q: A gain-of-function mutation is one in which a gene is expressed at the wrong time or in the wrong…
A: Hereditary qualities is a part of science worried about the investigation of genes, hereditary…
Q: The production of antibodies is an example of regulation of gene expression at which level?…
A: Gene expression is the process by which gene information is used for the synthesis of functional…
Q: What are two specific and different ways that neurotransmitter signaling at the membrane alters gene…
A: Neurotransmitters affect the post synaptic membrane thus forming either an Excitatory Post Synaptic…
Q: Epigenetic changes in gene regulation are caused by _ _ _ _ _ _ _ a. missing nucleotides or…
A: Epigenetics refers to both heritable and non heritable changes in gene expression that are not…
Step by step
Solved in 2 steps
- See figure 12.16b regarding the process by which cyclin regulates the Cdk. Suppose that the cyclin binding site in the Cdk contains these FOUR amino acids in this order from top to bottom: serine, lysine, aspartic acid acid and lysine and the Cdk binding site in the cyclin contains these FOUR amino acids in this order from top to bottom: aspartic acid, aspartic acid, lysine and serine. Use the schematics below to show the R groups and how they might interact to create the cyclin.cdk complex. Label both binding sites, show all charges that will be used to create any bonds, and label all bonds formed and add the ATP active site. A Explain what a kinase does and how the cyclin controls the activity of the Cdk.What is the abbreviated name of the human gene that contains the following sequence CAGATTGTGAAGAGGTCTCTTGA? ATR HBB XPA FGFR3 IDS XRCC1 p53 F8 APC ERCC3Since all cells contain the same number of chromosomes and the overall same/similar genome how would the genome in a nerve cell work differently than the genome of a muscle cell? In other words what epigenetic processes cause these differences between cell types at the molecular level
- Certain mutations called amber in bacteria and viruses result in premature termination of polypeptide chains during translation. Many amber mutationshave been detected at different points along the gene thatcodes for a head protein in phage T4. How might this system be further investigated to demonstrate and support the concept ofcolinearity?What is a proto-oncogene? What are the typical functions of proteinsencoded by proto-oncogenes? At the level of protein function,what are the general ways that proto-oncogenes can beconverted to oncogenes?Using specific molecular evidence, elaborate on the remark "oocyte activation entails inactivation."
- Why is TP53 called the Guardian of the genome?Define epigenetics. Are all epigenetic changes passed from parentto offspring? Explain.The P63 and P53 have similar functionalities in the cell, however, p53 is rarely associated directly with p63, suggesting that p63 may indirectly act as an oncogene by blocking p53 function. This hypothesis may also explain why p63 is associated with other indications of misinterpretation. I do understand the above statement, however once piece not clear – why would p63 block p53 function? Have these genes been shown to have opposing functions? From the background information provided above, it seems like they would have seminar functions. Explain.
- Some people have a genetic predisposition for developing priondiseases. Examples are described in Table 25.6. In the case ofGerstmann-Straüssler-Scheinker disease, the age of onset istypically 30–50 years, and the duration of the disease (whichleads to death) is about 5 years. Suggest a possible explanationwhy someone can live for a relatively long time withoutsymptoms and then succumb to the disease in a relativelyshort time.Identify two genetic mechanisms whereby proto-oncogenes can become overexpressed. Select the two mechanisms. Identify two genetic mechanisms whereby proto-oncogenes can become overexpressed.Select the two mechanisms. 1) alterations in chromatin structure 2) a gain-of-function alteration 3)modification of proto-oncogenes products 4)mutations that result in an abnormal protein product 5)mutations within gene-regulatory regionsWhy is it advantageous for p53 to be activated by factors such as ER stress, light, and hypoxia (low oxygen concentration)?