All are propertles ofnucleosomes EXCEPT: / Almalis eienskappe vannukleosome, behalwe:A. all are true / almal iİs waar.B. DNA binds histones by ionicbonds of positively charged aminoacids and the negative chargedphosphate groups / DNA bind histonedeur ioniese bindings van positiefgelaaide aminosure en die negatiefgelaaide fosfaatgroepe.C. protein spools neatly wrappedwith DNA. / proteïen spoelle netjiestoegedraai met DNA.D. protein spools made up ofpairs of histones H2A, H2B, H3 andH4 octameric aggregates. / proteïenspoelle wat bestaan uit pare histoneH2A, H2B, H3 en H4 octamerieseaggregate.E. fundamental structural unit inchromatin. / fundamentelestrukturele eenheid in chromatien. All are true for DNApolymerase EXCEPT: / Almalgeld vir DNA-polimerase,BEHALWE:A. generates dsDNA from SSDNA /genereer dsDNA vanaf SSDNAB. requires a primer with a free 5'-OH end, but the 3'-end may bephosphorylated / benodig 'nvoorvoerder met 'n vrye 5'-OH-groep,maar die 3'-einde kan gefosforileerword.C. copies the sequence ofnucleotides of one strand in acomplementary fashion. / kopieer dievolgorde van nukleotiede van eenstreng komplementêr.D. synthesizes new strands byadding successive nucleotides in the5'→3' direction. / sintetiseer nuwestringe deur opeenvolgendenukleotiede in die 5 '→ 3' rigting toete voeg.E. copies the sequence ofnucleotides of one strand to form anew second strand. / kopieer dievolgorde van nukleotiede van een

Nucleosome They are fundamental repeating subunits of all eukaryotic chromatin (except when…

All are propertles of nucleosomes EXCEPT: / Almal is eienskappe van nukleosome, behalwe: A. all are true / almal is waar. B. DNA binds histones by ionic bonds of positively charged amino acids and the negative charged phosphate groups / DNA bind histone deur ioniese bindings van positief gelaaide aminosure en die negatief gelaaide fosfaatgroepe. C. protein spools neatly wrapped with DNA. / proteïen spoelle netjies toegedraai met DNA. D. protein spools made up of

All are propertles of nucleosomes EXCEPT: / Almal is eienskappe van nukleosome, behalwe: A. all are true / almal is waar. B. DNA binds histones by ionic bonds of positively charged amino acids and the negative charged phosphate groups / DNA bind histone deur ioniese bindings van positief gelaaide aminosure en die negatief gelaaide fosfaatgroepe. C. protein spools neatly wrapped with DNA. / proteïen spoelle netjies toegedraai met DNA. D. protein spools made up of

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 17P

See similar textbooks

Similar questions

#2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
FIGURE 2 shows the only suitable DNA restriction site in a plasmid DNA vector that can be cleaved. 5'.GTAATCCGGATCCGAAATCCCCCGG... 3' 3.CATTAGGCCTAGGCTTTAGGGGGCCC... 5 FIGURE 2 Identify the most suitable enzymeto be used as a restriction enzyme forthis purpose. O Ligase O Smal O EcoRI О ЕсoRV
#4 BamI --- 5’ CCTAG ↓G 3’ 5’ ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3’ 3’ TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
y Cours S DIOE The following DNA fragment shows where a number of restriction endonucleases cut sites occur within the fragment. The numbers below indicate the distance between those cut sites in base pairs (bp). Kpn I Sall Eco RI Pst Bam HI Xho Bam HI Pst i Eco RI Kon I 100 200 300 400 500 B00 700 800 900 1000 1100 1200 1300 1400 1500 1600 1700 1800 1900 2000 How many total restriction fragments will result if you complete digest the DNA fragment above with Sal I? cross out a. 1 cross out b. 2 cross out O c. 3 cross out d. 4 cross out e. 5 cross out O f. 6 cross out g. 7 cross out Oh. 8 The following DNA fragment shows where a number of restriction endonucleases cut sites occur within the fragment. The numbers below indicate the distance between those cut sites in base pairs (bp). t of Sal Eco RI Pat Xhol Bam HI Psti Eco RI Koni Kpn i Bam H
Kha Vu Danels Include: 8DX : Safehy Jor bromie tnto lab repart! Name Section date sheet MAPPING PRACTICE #1 Below is a restriction map for the plasmid PGEN 101 (total length = 20 Kb). Using this map as a guide, give the number of restriction fraqments along with their associated lengths that would result from digesting PGEN 101 with the restriction enzymes EcoRI, BamHI and a combination of ECORI and BamHI. BamHI 3.2 Kb 1.7 Kb EcoRI BamHI PGEN 101 8.7 Kb 5.5 Kb .9 Kb EcoRI ECORI DIGESTION PERFORMED SIZES OF FRAGMENTS OBTAINED 10.4 kb , 0.9kb, 8.7 Kb EcoRI 3.2 Kb, 16. 8kb BamHI EcoRI + BamHI
Map of pUC18 is shown on the here. Describe how to select recombinant clones if a foreign DNA is inserted in to the polylinker site of pUC18 and then introduced into E. coli cells.. Hindll Sphl Sbfl Pstl BspMI Acci Hincli Sall Xbal BamHI Aval Smal Xmal Acc651 Kpnl Banll Eco53kl Sacl Apol ECORI lacz MCS LacR binding site Plac PUC18 Amp 2686 bps PMB1 ori
#1 HindII --- 5’ GTC ↓ GAC 3’ 5’ ACGACGTAGTCGACTTATTAT GTCGACCCGCCGCGTGTCGACCATCA 3’ 3’ TGCTGCATCAGCTGAATAATACAGCTGGGCGGCGCACAGCTGGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
What type of molecule or cell is PGLO? C Origin region Arabinose operon arac ori Ndel Promoter PaaD PGLO (5,400bp) Ndel Ampicillin Resistance Gene Amp Hindll Ndel Green Fluorescent Protein (GEP) Gene Hindll 'ECORI GraphiceESchmid/2003 D O virus O RNA plasmid molecule O DNA plasmid moelcule O none of the choices are correct
#3 HaelII --- 5’ CC ↓ GG 3’ 5’ ACGCCGGCCGTATTAT CCGGATCCGCCG CCGGCTGTCCCGGATCA 3’ 3’ TGCGGCCGGCATAATAGGCCTAGGCGGCGGCCGACAGGGCCTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
DNA polymerase delta has Pril subunit that can generate RNA primers O True O false
What Art the Features of the Series of -omes? Define the following terms: a. Genome b. Transcriptome c. Proteome d. Metabolome e. Fluxome
Match each term with the most suitable description. ______ DNA profile a. GMO with a foreign gene ______ Ti plasmid b. alleles commonly have them ______ probes c. unique array of short tandem repeats ______ SNPs d. used to find clones. ______ transgenic e. mouse vs. human ______ genomics f. used in plant gene transfers ______ CRISPR g. based on RNA interference