AKS 5b: Which model accurately represents the semi-conservative nature ofDNA replication? *AAAAAAAAАВ ВАAA BBAA AAAB ACFigure AFigure BFigure CFigure DFigure AFigure BFigure CFigure DAKS 5b: Use the models below to answer the question that follows. Which modeland explanation best represents the semiconservative nature of DNA? *

AKS 5b: Which model accurately represents the semi-conservative nature of DNA replication? * AA AA AA AA АВ ВА AB BA AA BB AA AA АB АC Figure A Figure B Figure C Figure D O Figure A O Figure B Figure C Figure D Which model

AKS 5b: Which model accurately represents the semi-conservative nature of DNA replication? * AA AA AA AA АВ ВА AB BA AA BB AA AA АB АC Figure A Figure B Figure C Figure D O Figure A O Figure B Figure C Figure D Which model

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter15: Genes And Proteins

Section: Chapter Questions

Problem 27CTQ: Transcribe and translate the following DNA sequence (nontemplate strand): 5'- ATGGCCGGTTATTAAGCA-3'

See similar textbooks

Related questions

Q: 18. Choose the correct number of DNA molecules created after 6 cycles of PCR. a. 6 b. 16 c. 32 d. 64…

A: Introduction The polymerase chain reaction (PCR) is a widely used method for rapidly making…

Q: Transcribe the follwing DNA strand into a RNA strand. GTC L8R CAG GTC AUG

A: Transcription is the first step in molecular biology's core dogma: DNA RNA. It is the mechanism of…

Q: Wxplain why the 5’-to-3’ rule creates a conundrum during replication.

A: Answer

Q: Using the picture below, match each letter (A-E) to 5' or 3' DNA polymerase molecule Parental DNA…

A: As the options are not visible, we are answering the question based on the general principle of DNA…

Q: Match the statement to the corresponding agent/key player in DNA replication. Some items require…

A: DNA replication is the biological process where a double-stranded DNA molecule is copied or…

Q: Which DNA–repair mechanism would most likely correct the incorporated error labeled by balloon 2 in…

A: DNA (deoxyribonucleic acid) damage or abnormality can occur during the cell cycle of a cell. It…

Q: AKS 5b: Using the semi-conservative model of DNA replication, how many of the resulting DNA…

A: Semi conservative replication The replication of DNA is semi conservative in nature because the…

Q: 1. For cach of the items below, give a brief description (indicate function for enzymes) and…

A: All the above-mentioned enzymes are part of the central dogma of the cell. It consists of three…

Q: Which of the DNA polymerases shown in Table have the ability to proofread?

A: The DNA polymerase enzyme uses a single stranded DNA molecule as a template and causes the synthesis…

Q: Match each statements below with the appropriate letter from the replication fork diagram. 1.…

A: 1. Removal of RNA primers and joining of Okazaki fragments. Because of its 5′ to 3′ exonuclease…

Q: Which DNA polymerase in prokaryotes is involved in the replacement of primers with deoxynucleotides?…

A: DNA polymerase is the enzyme that catalyses the replication of DNA. DNA polymerase cannot synthesise…

Q: 2. Refer to the protein phe-trp-tyr-cys-ala-met-leu, construct a DNA strand that can transcript an…

A: mRNA stands for messenger RNA which is a single stranded RNA molecule that is complementary to one…

Q: AKS 5c: Which student correctly explained what is occurring in the images? * 3" ECCUAL FAC 3 Met Leu…

A: The deoxyribonucleic acid (DNA) is the genetic material of all organisms, which involves the…

Q: iginal mplate) HA denine Thymine Cytosine Guanine nzymes and structures to label: hromosome…

A: A chromosome is a long DNA molecule with part or all of the genetic material of an organism.Most…

Q: II. The base composition of a single stranded DNA, which is 1000 bases long is the following: A =…

A: A parent DNA molecule makes two DNA double helix in a single round of DNA replication.

Q: Which of the following enzymes is responsible for the bulk of DNA synthesis during replication in…

A: DNA pol I,II and III are present in prokaryotes. However it is the DNA polymerase III which is…

Q: Can you please answer number 15

A: DNA replication is a biological process in which the double-stranded DNA molecule is copied into two…

Q: (a) What is the function of helicase in DNA replication? (b) What is the function of DNA polymerase?…

A: DNA is called deoxyribonucleic acid. DNA act as genetic material in most organisms. DNA replication…

Q: 11. Refer to the figure showing a single replication fork. E A D Which statement about the…

A: DNA replication is a process by which DNA used its own strand for the generation of novel strand .…

Q: AKS 5b: Use the image below to answer the question that follows. Below are the interpretations of…

A: The process in which the DNA makes the exact copy of itself while the process of cell division. This…

Q: QUES Place the following enzymes in the correct order, in which they function in DNA replication:…

A: DNA replication is the process of copying genome's DNA. It occurs in three steps - Initiation…

Q: Acts at oric to initiate DNA replication by denaturing dsDNA Choose... Counteracts topological…

A: DNA replication is a complex process which involves replicating another strand of DNA according to…

Q: DNA replication isa) Conservativeb) Non-conservativec) Semi-conservatived) None

A: Deoxyribonucleic acid (DNA) is a genetic material present in most of the living organisms. DNA…

Q: Define the following terms:a. processivityb. replisomec. exonucleased. DNA ligasee. replication fork

A: Deoxyribonucleic acid or DNA is a nucleic acid that composed of two polynucleotide chain that is…

Q: The region of DNA, shown below, is being copied. Diagram what happens when the second GT repeat…

A: WT replication without slippage:

Q: Transcribe the following DNA strand into a RNA strand. CAA a BFF GUU CAA GTT

A: DNA strands change into mRNA by transcription.

Q: F H. B D H G OVERVIEW C 1. lagging strand 2. DNA polymerase v A v B 3. origin of replication v D 4.…

A: DNA replication is necessary to ensure genetic continuity and genome inheritance from parents to…

Q: 36/ In the figure representing DNA replication represents the leading strand? AA C.C DD None of the…

A: DNA replication means making a replica or copy of the DNA strands. DNA is a double-stranded…

Q: Complete the complementary strand: DNA replication ATTCGAGGCTAA

A: DNA (deoxyribonucleic acid) replication is the fundamental process occurring in the cell by which…

Q: AKS 5a: If a DNA strand has 32 % guanine before semi conservative replication occurs, what percent…

A: A single molecule of DNA will have four types of nucleotide bases, adenine (A), guanine (G),…

Q: Doea DNA Polymerase 3 have any functions outside of DNA replication?

A: DNA polymerase 3 is a complex enzyme that contains ten different polypeptides (alpha, sigma, gamma,…

Q: DNA polymerase III adds a nucleotide to the 3' end of the strand. leading strand. All of the answers…

A: Concept used: DNA Replication DNA Replication : The process where the strands of DNA are…

Q: AKS 5c: Which of the following answers below accurately describes Strand C in the model? * Strand A…

A: DNA and RNA are both nucleic acids made up of 4 nucleotides connected to each other in particular…

Q: During DNA replication, the two new daughter DNA strands have to be made at the same time in the…

Q: What the most likely cause of mutation CCC to CCG? Select an answer and submit. For keyboard…

A: Mutation as the process to change or cause a permanent change in the DNA of an organism. This can be…

Q: Match the letters with the enzyymes and macromolecules invoived DNA replication: A B INCOMING…

A: There are number of processes necessary for the continuation of generation , growth and…

Q: Choices: Origin of replication Bubble SSBP RPA Sliding Clamp PCNA DNA Pol III Pol ε Pol δ DNA Pol I…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: pol III moves 5 pol I replaces primer A with DNA pol I binds to 5 end of primer A DNA ligase links…

A: DNA replication is the biological process of producing two identical replicas of DNA from one…

Q: Which of the following is not necessary for replication to proceed? O MRNA RNA primer DNA polymerase…

A: The answer is m-RNA.

Q: hy natural blunt ends are not recognized as DNA damage during replication? Is it good or bad?…

A: DNA harm happens continuously as a result of numerous factors—intracellular metabolism, replication,…

Q: Choices: Origin of replication Bubble SSBP RPA Sliding Clamp PCNA DNA Pol III Pol ε Pol δ DNA Pol I…

A: Processivity refers to the average number of nucleotides added before polymerase enzyme dissociates…

Q: AKS 5b: Use the image below to answer the question that follows. Below are the interpretations of…

A: The DNA (deoxyribonucleic acid) is the genetic material of an organism. The DNA is present in the…

Q: 1. An embryo replicates its DNA every 5 minutes. What is the maximum distance that origins of…

A: Replication is duplication process requiring copying from a template. It occurs in case of DNA.…

Q: In the following diagram of DNA replication fork, A is a subunit of DNA polymerase Ill. O b. y…

A: DNA polymerase III is used in the synthesis of Chromosomal DNA. DNA pol III participates in the DNA…

Q: 11. Refer to the figure showing a single replication fork. E A Which statement about the replication…

A: DNA stands for deoxyribonucleic acid. It is the genetic material present in the nucleus.

Q: 9. a. Describe the experiment that determined DNA is the genetic material. b. Describe the…

A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via a…

Q: Ku proteins involve. nucleotide excision repair DNA repair before S phase single DNA strand break…

A: The Ku proteins bind to the ends of the linear phage DNA and stimulate LigD to ligate the ends to…

Q: 60 Which enzyme is involved in strand separation to begin the process of replication? Select an…

A: Enzyme Helicase breaks the hydrogen bonds present between nitrogen bases of 2 strands of DNA and…

Q: In eukaryotes, DNA replication is initiated at an origin of replication by a. DnaA proteins. b. the…

A: Eukaryotes are modern day organisms with a nucleus and cell organelles that are bounded by…

Q: Match the items on the diagram with the correct term below. 3' 5' 5 D 8 Activate W DNA Replication…

A: DNA replication is the procedure through which cells make copies of the DNA. A cell must first copy…

Question

AKS 5b: Which model accurately represents the semi-conservative nature of
DNA replication? *
AA
AA
AA
AA
АВ ВА
AA BB
AA AA
AB AC
Figure A
Figure B
Figure C
Figure D
Figure A
Figure B
Figure C
Figure D
AKS 5b: Use the models below to answer the question that follows. Which model
and explanation best represents the semiconservative nature of DNA? *

Expert Solution

Step 1 Introduction

DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most animals except for some viruses. A nitrogen base, sugar molecule, and phosphate groups make a nucleotide. Nucleotides are the structural components of nucleic acids. DNA molecule undergoes the process of replication.

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

AKS 5c: Which student correctly explained what is occurring in the images? AEGCEE ECCUAE FACGAAAGCAEA 3' Met Leu Ser Tyr Tyr Gle Ser le Met Leu Ser Tyr Tyr Glu Ser le The 4th student explains the first arrow must demonstrate how the base pairing rule is being used to replicate a strand of DNA since the complementary pairs are being O lined up for semi conservative replication. The second arrow must demonstrate the process of transcription since the DNA is being read at the ribosomes and the monomers of protein are being connected. The 1st student explains the first arrow must demonstrate how the base pairing rule is being used to replicate a strand of DNA since the complementary pairs are being lined up for semi conservative replication. The second arrow must demonstrate the process of translation since the RNA is being read at the ribosomes and the monomers of protein are being connected. The 2nd student explains the first arrow must demonstrate how the base pairing rule
For the chromatogram below, what is the sequence of the template DNA from base 115 to 125? CTGTGTGAAA TTGT TA T C CGC T CACA A T TCCACA CA A CATACGAG CCGGAAG CA T AA 110 120 130 140 150 160 СТТТААСАAТА ТАTTCAATTТС ATAACAATTTC GAAATTGTTAT
EcoRI recognizes G A-A-T-T-C sequence and cleave/ cut between G and A. How will the DNA fragments look like if EcoRI is used for the DNA below? How many fragments are produced? 5- AAAGATTTGAATTTCGAATTCAATTTAAGAATTCCCTTAGAATTTCC -¹3
a) Explain semi-conservative modelmof DNA replication b) discuss initiation in DNA replication and explain why it is a tightly controlled process.
a. As a result of the structure of DNA and RNA, replication, transcription and translation are possible. What can nucleic acids do, as a result of their structure, that enables these processes to occur? The figure below shows a simplified schematic representation of a segment of DNA. The DNA is labelled with the numbers 1 – 14 for easy reference. -35 sequence Pribnow box 5' UTR 3' UTR DNA TTGACA TATAAT -35 -10 Gene a Gene B Gene y 1 2 3 4 5 6 7 8 9 10 11 12 13 14 UTR = untranslated region b. At which position on the DNA (number 1 - 14) will transcription be initiated? c. At which position on the DNA (number 1 - 14) will the first signal for translation be found? d. Between which two regions on the DNA will the polyadenylation signal be found? Use the numbers to indicate the region. e. Between which two regions on the DNA will the first Shine-Dalgarno / Ribosome Binding Sequence be found? Use the numbers to indicate the region.
Give the complimentary DNA strand for the following:ACG TAG CTA GTC AGT CGT AGC Give the RNA strand for the following:ACG TAG CTA GTC AGT CGT AGC Using the provided amino acid table and the RNA strand you created in #2, create the amino acid sequence: Name and explain two different ways in which DNA can be damaged. Once DNA is damaged, can we repair it? If not, what are some possible outcomes from the damaged DNA?
AUG Met ACG ANALYSIS ANALYSIS: A DNA strand undergoes all the process included in the central dogma. The DNA strand used as a template is given below: Parent strand DNA: 5-AGA-ACT-AAA-СТА-ТCG-СТT-CGT-3 DNA daughter strand: hnRNA: MRNA: original protein: mutated MRNA: mutated protein: second letter G UCU UUU Phe UAU Tyr UGU UGC Cys UAA stop UGA stop| A UAG stop UGG Trp UUC UCC UAC Ser Leu UCA UUG UUA UCG G CUU CCU CAU CGU His CAC CAA CUC C CGC Leu CUA Pro Arg A ССА CGA Gln CAG CUG CCG CGG AUU ACU AAU AUC lle A AUA AAC Asn AAA AGC AGA AGU Ser ACC Thr АСА AAG LyS GAU ASP AUG Met ACG AGG Arg G GUU GCU GGU) GUC GCC GAC GGC Val GUA GCA Ala GAA Gly GGA A Glu GUG GCG GAG GGG G Translating the unmutated MRNA that was obtained after splicing, the original protein sequence will be? The original protein is [A] (For your answer, use the one-letter symbol (all caps) for the amino acid residues separated by dashes, e.g. C-A-S-H). first letter third letter
Which of the following sequences on a DNA molecule would be complementary to GCTTATAT? TAGGCGCG ATCCGCGC CGAATATA TGCCTCTC
Transcribe and translate the following DNA sequence (nontemplate strand): 5'- ATGGCCGGTTATTAAGCA-3'
Generate a concept map that includes all the specifics below: • Classification based on: 1. their effect on the DNA 2. on their phenotypic effect. . Kinds of DNA damage and lesions (spontaneous and induced) produced by specific exposures. (Note: don't forget transposons and CRISPR Cas9) Specific repair mechanisms that fix each kind of DNA damage or lesion (during/post replication). • Include information about the number of replication cycles for a dominant mutation to cause a phenotype. And the number of cycles for a recessive mutation to possibly cause a phenotype. (Hint: don't forget to think about each strand of both parental copies of each chromosome) O
Examine the DNA model, what are the features that contribute to the stability and the ability of the DNA to replicate faithfully? Identify the specific molecule represented by the following colored plastic chips. Color Molecule Represented BrownWhiteOrangeBlueGreenRedPinkYellow
1c) During DNA replication, both positive and negative supercoiling is introduced in the DNA being replicated. Name the enzymes that introduce supercoiling into DNA during replication; please clearly indicate which enzyme(s) introduce positive supercoiling and which enzyme(s) introduce negative supercoiling.