Answered: Abnormalities in the number of X…

Abnormalities in the number of X chromosomes tend to be milder than the same abnormalities in autosomes because of ________.a. deletionsb. nonhomologous recombinationc. synapsisd. X inactivation

Concepts of Biology

1st Edition

ISBN:9781938168116

Author:Samantha Fowler, Rebecca Roush, James Wise

Publisher:Samantha Fowler, Rebecca Roush, James Wise

Chapter7: The Cellular Basis Of Inheritance

Section: Chapter Questions

Problem 10RQ: Abnormalities in the number of X chromosomes tend to be milder than the same abnormalities in...

See similar textbooks

Related questions

Q: what is the decimal reduction time?

A: D-value or the Decimal reduction rate is the required time to achieve 90% killing/ reduction of…

Q: sperm

Q: Use the image below to answer questions 2-3. As part of his series of experiments, Connell removed…

A: Competition When two species compete for the same thing like place, food, water, ect then this…

Q: The alternation of generations life cycle applies to gymosperms in that: A. the gametophyte stage…

A: Gymnosperms are vascular plants that produce seeds but not flowers.

Q: Using a flow diagram, elaborate on how you would generate a recombinant plasmid that can be used for…

A: Introduction A plasmid is a distinct segment of extrachromosomal DNA that is physically distinct…

Q: Identify the type of division exhibited by the following: Binary fission Grasses Hydra Budding…

A: >> Grasses Grasses reproduce sexually by seeds and asexually by vegetative propagation. In…

Q: A. Let us see if you can help Draky, who traveled from home to his work using bicycle, but has been…

A: Introduction : The four blood group types in the ABO system are A, B, AB, and O. These blood groups…

Q: Fats can be dispersed into small droplets by: a. Emulsification b. Digestion c. Goblet cells d.…

A: Fats, along with carbohydrates and proteins, are one of the three major macronutrient groups in the…

Q: Cells form the tissues found in the human body. The four primary tissue types combine to form all…

A: The cells are the smallest structural and functional unit of the body. The group of cells that…

Q: On your own understanding, explain the cell theory.

A: Introduction The basic and structural component of life is the cell. Cell biology is the study of…

Q: What anatomical feature in digestive cells allows more digestion? a. Goblet cells b. More nerve…

A: Digestion is a process involving the breakdown and metabolising of food particles to obtain…

Q: Which of the following subcellular structures facilitates intracellular transport?

A: The research of structure and function of cells is known as cell biology, and it is based on the…

Q: Identify the cell organelles labeled in these actual TEMs of human cells; list them on the lines…

A: A subfield of biology called cell biology examines the composition, operation, and behavior of…

Q: What new connection/articulation is made by the tetrapod pelvic girdle, relative to fish? To which…

A: Introduction:- Fishes and tetrapods are categorised under the chordata because of the presence of…

Q: Rehpogs are mythical creatures. They are small and not very smart. Rehpogs live on the ground in a…

A: Introduction Inheritance patterns are of different type’s Mendelian inheritance, incomplete…

Q: For the following problem 4 coins are tossed Find P( not all heads) enter this as if it were on…

A: if four coins are tossed you have the possibility for heads/tails for each coin. coin 1: Heads /…

Q: Two pea plants, each genotype TT, Tt Knowing that the allele of tall leg is T, allele short leg is…

A: Given Allele T - for tall t - for short T - dominant t - recessive Parent genotype and…

Q: Choose one prokaryote (bacteria or archaea) AND one protest. You can choose a species or more…

A: Name of bacteria chosen is Lactobacillus plantarum They are long rod shaped bacillus bacteria with…

Q: Choose one of the following scenarios. Describe the scenario. Describe the chain of events terms of…

A: Tonicity It is the capability of cell to loose of gain water of the cell. The movement of water…

Q: Which of the following would inhibit the function of the JAK-STAT Pathway? Multiple answers A.…

A: JAK-STAT pathway is activated in response to cytokines (interferons and interleukins). The receptor…

Q: Which of the following statements is TRUE about phospholipids? The hydrophobic fatty acid tails on…

A: Phospholipids are major components of the plasma membrane, plasma membrane is the external covering…

Q: Low Medium Magnifying power High Ocular Objective 10 10 40 100 Prepared slides The diameter of the…

Q: Not all prokaryotic cells have flagella. What are bacteria without flagella called?

A: Introduction:- Prokaryotic cells are characterized by absence of a well defined nucleus and membrane…

Q: Compare the homebased DNA extraction method with the Phenol:Chloroform extraction method.

A: DNA extraction: The process of extraction of DNA from the cell can be done by various methods.…

Q: Given that the maternal genotype is TT and the paternal genotype is tt, identify the probable…

A: Meaning of some useful terms : 1. Genotype: genetic constitution, represented by allelic…

Q: Describe the ff types of microscope: A. Darkfield microscope B. Phase contrast microscope C.…

A: Microscope is an equipment that can help to observed very small object and cells.

Q: following method is employed in the sample preparation for the cryo-electron microscope? O The…

A: Cryo preservation is a process where organic matter is preserved at extremely cold temperatures. In…

Q: Species interactions determine an organism's fundamental niche. True False

Q: QUESTION7 Tine has type O blood and her sister Rose hes type All blood. What are the blood genotypes…

A: Introduction There are four different types of blood groups are found in human. Blood group A, B, AB…

Q: . In theory, PCR exponentially amplifies a DNA fragment for x number of cycles. However, the…

A: Introduction:- PCR is known as the polymerase chain reaction. It is a biophysical technique which is…

Q: Which of the following is the most likely reason that many ribosomes do not attach to the surface of…

A: A ribosome is an intercellular structure composed of RNA and protein, and it serves as the site of…

Q: Q .2 Provide a brief (2-3 sentences), but detailed, definition/explanation/identification of…

A: Human conduct has an impact on one's daily existence. Humans establish opinions about one another…

Q: Species interactions influence an organism's realized niche. True False

A: The actual conditions and resources that a species relies on to survive as a result of biotic…

Q: Remove codons 24 to 66, inclusive AUGUUUGUACAUUUGUGUGGGAGUCACCUGGUUGAGGCGU

A: GENETIC CODE The genetic code is the relationship between the sequence of bases in DNA and the…

Q: Do the Paramecium show any signs of being electrically charged? If so, do they carry a positive or a…

A: Paramecium:- this organism belongs to eukaryotes having true nucleus. This is an unicellular,…

Q: For some time there has been evidence that the Bacille Calmette-Guérin (BCG) vaccine provides…

A: The vaccine shows its response by acting on the immune system. BCG or bacilli Calmette-Guerin, is a…

Q: Minimize pipette handling Questions : How important is it to transfer the proper liquids in their…

A: Pipette is a safe method by which small amount of liquid can be transferred from one location to the…

Q: Propose an adaptive significance for the large number of gametes produced and released by sea…

A: Introduction: Any of the around 950 existing species of sea urchins (phylum Echinodermata, class…

Q: How do SSRI and MAOIs work? Which parts of the neural communication machinery do they target? Which…

A: SSRI and MAOI are the strong classes of anti depressants. SSRI is serotonin reuptake inhibitors MAOI…

Q: Upper Intertidal Zone Lower Intertidal Zone Balonus kalenvides Chthamalus scellatus The diagram…

A: Introduction: Connell is an American ecologist, but because his research on how interspecific…

Q: Identify three enzymes found in the body, their likely location inside the body, and the pH at which…

A: Enzymes are biocatalyst that perform specific chemical reaction. They are proteinaceous in nature…

Q: Where would you expect competitive exclusion to occur most quickly? (Choose the one best answer.)…

Q: How did developments in cytology in the nineteenth century contribute to our modern understanding of…

Q: What part of the structure is represented by the second chain having the order Asp- Asp-Ser-Val?

A: Proteins are made by linking amino acids with the help of peptide bonds. They form a chain that also…

Q: "The cuticle and its profound effect on the organisation and functioning of the insect body".…

A: Introduction : Insects belong to the class Hexapoda, or Insecta, which is the biggest division of…

Q: Which vertebrates have reduced coracoids bones &/or clavicles? What is the benefit of this change?…

A: vertebrate : an animal (as a fish, amphibian, reptile, bird, or mammal) that has a backbone…

Q: If the plasma membrane becomes more permeable to Cl-, would there be Clinflux or Cl- efflux at an…

A: The resting membrane potential, often known as the resting potential, is a voltage across the…

Q: Name the physiological systems used to control the function of physically distant organs/tissues?…

A: Physiological system It is the system of our body that performs the major work like digestion,…

Q: Reduced tailbones and the associated remnant muscles in humans are an example of what type of…

A: Common descent means common ancestory. Various evidences for the same are homologous organs,…

Q: Question 4. Now look at all the graphs. Which trait, beak length or wing length, has changed the…

A: Several processes contribute to evolutionary change. Natural selection, the differential success in…

Question

Abnormalities in the number of X chromosomes tend to be milder than the same abnormalities in autosomes because of ________.
a. deletions
b. nonhomologous recombination
c. synapsis
d. X inactivation

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Abnormalities in the number of X chromosomes tend to be milder than the same abnormalities in autosomes because of _______. a. deletions b. nonbomologous recombinat ion c. synapsis d. X inactivation
Using the symbols above: 1. Given: Adult diploid cell (2n = 8) 2. Show the condition of the chromosomes in the following Mitosis phases (illustrate): a. prophase b. metaphase c. anaphase d. telophase/cytokinesis
Human cells normally have 46 chromosomes. For eachof the following stages, state the number of nuclear DNAmolecules present in a human cell:a. Metaphase of mitosisb. Metaphase I of meiosisc. Telophase of mitosisd. Telophase I of meiosise. Telophase II of meiosis
a. If a set of chromosomes is one copy of each kind of chromosome, how many sets are in a human sperm_____. How many chromosomes are in a human sperm____. b. How many sets of chromosomes are in a human egg_____. How many chromosomes are in a human egg_____. c. Why is there such a different in size and number of sperm cells in the testes compared to the number of oocytes in the ovaries ?
Two chromosomes have the ff. order of genes: Normal A B centromere C D E F G H I Abnormal a b centromere g f e d c h i a. Does the abnormal chromosome have a pericentric or paracentric inversion? Why? b. Draw a sketch to show how these two chromosomes (duplicated) would pair during synapsis. Assume a CO will occur between genes E and F. What gametes are ultimately formed at the end of telophase II and describe.
During the observation of a baby the diagnosis of Down's syndrome was made. What is the main cause of this pathology? Select one: a. Trisomy on the 13-th chromosome. b. Trisomy on the 21-st chromosome. c. Trisomy on X chromosome. d. Monosomy on the 1-st chromosome. O e. Undivergence of sex chromosomes.
Which of the following situations does not describes a chromosomal mutation? Select one: a. A cytosine nucleotide is substituted for thymine nucleotide in a gene. b. A portion of Chromosome 4 is deleted during interphase of meiosis. c. The sister chromatids of Chromosome 18 do not separate during anaphase II. d. A section of Chromosome 17 is duplicated leading to problems in the peripheral nervous system.
During crossing over,a. chromatids of homologous chromosomes exchange parts.b. mutations occur with higher than average frequency.c. chromatids of nonhomologous chromosomes exchange parts.d. nondisjunction occurs.
and down syndrome the victim has an extra chromosome 21. Therefore, down syndrome is a kind of ___ and results from ___. A. aneuploidy... nondisjunction of chromosome 21 during meiosis B. polyploidy... occurrence of meiosis without cytokinesis C. translocation… insertion of a transposon into chromosome 21 D. replication air… An extra cycle of DNA synthesis during the five phase
During meiosis both recombinant and parental type chromatids are created. Which of the outcomes below best represents a pool of gametes from a single chromosome? A || C |||||||||||| || E |||||||||||| A. A OB.C OC. E B D оос O D.D OE. B
The human X and Y chromosomes a. are about the same size and have approximately the same number of genes b. include genes that determine an individual's sex c. are almost entirely homologous, despite their different names d. are both present in every somatic cell of males and females alike
Help me