a. The column to the far left identifies the sequence type. Based on the nucleotides given, fill in the words "template" and "coding" (non-template) for the two DNA strands as soon as you figure out which is which. (hint: look at mRNA) b. In the second and last columns, write the polarity of the ends of each sequence (5', 3', N or C). c. The remaining columns represent transcriptional and translational alignments. Fill in all nucleotides, assuming that the template sequences in the table are read from LEFT to RIGHT d. Using the mRNA codon table provided on the next page, determine the polypeptide sequence. This sequence is from the middle of a coding sequence, therefore you do not need a start sequence. T DNA DNA mRNA codon tRNA anticodon polypeptide A C GLY G U G G G C A U

a. The column to the far left identifies the sequence type. Based on the nucleotides given, fill in the words "template" and "coding" (non-template) for the two DNA strands as soon as you figure out which is which. (hint: look at mRNA) b. In the second and last columns, write the polarity of the ends of each sequence (5', 3', N or C). c. The remaining columns represent transcriptional and translational alignments. Fill in all nucleotides, assuming that the template sequences in the table are read from LEFT to RIGHT d. Using the mRNA codon table provided on the next page, determine the polypeptide sequence. This sequence is from the middle of a coding sequence, therefore you do not need a start sequence. T DNA DNA mRNA codon tRNA anticodon polypeptide A C GLY G U G G G C A U

Name: 1. In the sequence grid below, you will fill in all boxes with end po
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 1. In the sequence grid below, you will fill in all boxes with end polarity, nucleotide, or amino acid as described below.a. The column to the far left identifies the sequence type. Based on the nucleotides given, fill in the words"template" and "co

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Similar questions

The following statements are either accurate as written or contain some errors. You need to rewrite each as an accurate statement. Make sure that you do not change the material the sentence is about. Highlight or underline any changes that you make to statements. Thank you! 1. Primers cleave DNA at recognition sequences. They can produce either matching ends, which are fragments with overhangs, or it can produce blunt ends, which are fragments without overhanging ends. 2. Codons are three nonoverlapping (such that each ribonucleotide is only in one codon) ribonucleotides that specify a particular amino acid. They are "read" in a linear fashion by the ribosome to be translated into a polypeptide. 3. The diagram below is an illustration of an important molecule for transcription. It depicts a ribosome that has two important regions. Region A that attaches to an amino acid and Region B that contains a codon.
11) Examine the following two DNA sequences. Sequence 1: ATGCGATGCTAGCAT Sequence 2: ATGCGATGATAGCAT If both of these sequences code for proteins, how might the function of protein 2 differ from the function of protein 1? Use the table below for assistance. U C A G บบน UUC UUA UUG CUU CUC CUA CUG U Phe GUUT GUC GUA GUG Leu Leu AUU AUC lle AUA AUG Met or Start Val Ceweg 232 www... UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG C GCU GCC GCA GCG Ser Pro Thr Ala CAU CAC CAA CAG A AAU AAC AAA AAG UAU U UAC C UAA Stop UGA Stop A UAG Stop UGG Trp G Tyr GAA GAG His Gin Asn Lys GAU GAC Asp G c] Glu UGU UGC CGU CGC CGA CGG AGU AGC AGA AGG GGU GGC GGA GGG Cys Arg Ser Arg Gly U C A G U C A G U C A G by Calin me press A) Protein 1 and protein 2 will function exactly the same. B) Protein 1 will be shorter than protein 2, so they will not function the same. C) Protein 2 will be shorter than protein 1, so they will not function the same. D) Protein 2 has a different sequence, so it will function…
Shown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein that is 270 amino acids long. The first three bolded base pairs indicate the frame and include the coding region. 5^ ...GCTAAGTATTGCTCAAGATTAGGATGATAAATAACTGG 3^ 3^.. CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC 5^ Which strand is the template strand for transcription of this gene? Briefly explain how you know. An insertion of one base pair causes the protein to decrease in length by seven amino acids. With respect to the sequence given above, where does this insertion occur? A change of one base pair leads to the protein increasing in the length by one amino acid. With respect to the sequence given above, which base pair would you change, and what would you change this base pair for the protein to increase in the length by one amino acid?
Restriction enzymes recognize palindromic DNA sequences (i.e. sequences that read the same on both strands). An example of such a sequence is GAATTC – work out the reverse complement of this sequence if you need to convince yourself that it’s a palindrome. Write the sequence of a different six nucleotide palindromic DNA sequence that uses all four nucleotides – you only have to give the sequence of one strand, but you’re welcome to write out both.
Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…
Design a pair of primers to amplify the entire length of the following 45 base pair sequence.Make each primer 14 bases long. Write the sequences of the primers in 5' to 3' order.(Hint: It will help for you to write out BOTH strands of the DNA sequence listed below.5'-GATGCCCGTTGGATAAATTGGGCGTCTAGAATCGGTCACACTTAG-3'
Below are several DNA sequences that are mutated compared with the wild-type sequence. Eachis a section of a DNA molecule that has separated in preparation for transcription, so you are onlyseeing the template strand. For each mutated DNA sequence, translate and record the resultingamino acid sequence. What type of mutation is each? Wild-type sequence: 3’-T A C T G A C T G A C G A T C-5’ Mutated DNA Template Strand #1: 3’-T A C T G T C T G A C G A T C-5’Amino acid sequence of peptide:Type of mutation: Mutated DNA Template Strand #2: 3’-T A C G G A C T G A C G A T C-5’Amino acid sequence of peptide:Type of mutation: Mutated DNA Template Strand #3: 3’-T A C T G A C T G A C T A T C-5’Amino acid sequence of peptide:Type of mutation: Mutated DNA Template Strand #4: 3’-T A C G A C T G A C T A T C-5’Amino acid sequence of peptide:Type of mutation:
this is the worst figure i have ever seen. Evidently A and B are different but the same color? From what I understand A would be a sliding clamp, and B is Primase? Is F rna primer (I think personally) or representing the SSBP? this is the worst diagram ever. the words that are for labeling are as follows: DNA polymerase III, sliding clamp, helicase, single-stranded binding protein (SSBPs), topoisomerase, RNA primer, newly synthesized DNA, primase, and DNA ligase.
Consider the following DNA strand with the following nucleotide sequence: 3’-ATATCAGAGAATATCA-5’ The nucleotide sequence of the complementary DNA strand is . b. The nucleotide sequence of the antisense strand used in the transcription process is . c. The nucleotide sequence of the mRNA strand produced after the transcription process is 2. Compute for the base composition of a DNA molecule given that %T is 23% (reported to the nearest whole number; no need to add the % symbol). % A? %C? %G?
In 1984, Carolyn Greider was using to set up an experiment to find out the enzyme called telomerase that had the ability to add nucleotide repeats to telomeric region. * DNA oligonucleotide RNA oligonucleotide Crude E. coli cell extract none of the above [32P] dCTP DGTP
5' GTGCTAGCGGGAATGAGCTGGGATACTAGTAGGGCT 3' 3' CACGATCGCCCTTACTCGACCCTATGATCATCCCGA 5' Template Strand: 9. Using the template strand, transcribe the DNA above, Be sure you write your sequence 5 - 5 a indicate the 5' and 3' ends of any nucleic acid molecule(s). 10. Use the codon chart below to translate your mRNA into an amino acid sequence. Begin at the first codon. Third First position (5' end) Second position position (3'end) UGU Cys UAU Tyr Cc UGC Cys UGA Stop UGG Trp UCU Ser -Y UAC Tyr UAA Stop UAG Stop UUU Phe - F UUC Phe UUA Leu UUG Leu FL UCC Ser -- UCA Ser UCG Ser CGU Arg CGC Arg ER CGA Arg CGG Arg CCU Pro CAU His CUU Leu CUC Leu -- CAC His CAA Gln CAG Gln CCC Pro -P A - CUA Leu CUG Leu CCA Pro CCG Pro AAU Asn AAC Asn AGU Ser AGC Ser AGA Arg ACU Thr AUU lle AUC lle AUA lle AUG Met M ACC Thr -T ACA Thr ACG Thr A. AAA Lys K AAG Lys -R AGG Arg A. GAU Asp -D GAC Asp GGU Gly GGC Gly GCU Ala GUU Val GUC Val GCC Ala A -G GGA Gly GGG Gly A -V GUA Val GUG Val GCA Ala GCG Ala GAA Glu -E…
b. Now do this AGAIN assuming that the DNA and RNA templates are read right to left. DNA strand C DNA strand T G A MRNA codon C|A U TRNA anticodon G A polypeptide TRP