А. CELLULAR STRUCTURE AND BIOMOLECULE 1 & 2. Give two unique properties of the organelles emphasized by the endosymbiotic theory.
Q: 6. How would an increase in blood pressure affect the delivery of nutrients to body cells?
A: The blood is the medium that exchanges gases and nutrients with the cells. Blood flows through…
Q: 5. Discuss the nucleus and explain its immense functions.
A:
Q: 15. Describe 4 functions of cytoskeletal proteins. А.
A: Cytoskeleton is the network of fiber forming "infrastructure" of eukaryotic , prokaryotic . It is…
Q: 1.Describe the metabolic pathways utilized by the red cell.
A: RBCs cannot depend on aerobic glycolysis, as in the Krebs's cycle, fr extraction of energy from…
Q: b) Use the DNA sequence below to answer the following questions. 3'- TACGAACGAGTGCCCCAAAATT -5' What…
A: The process of converting DNA instructions into proteins is known as the central Dogma.
Q: 25. Which of the following best defines cell theory? A) It is the scientific theory that states that…
A: All living organisms are formed from cells. This was laid out in Cell theory given by 3 scientists,…
Q: 6. What other type of cell death exists? Give its definition. 7. Give a splashful characterization…
A: Types of cell death : 1. Apoptosis 2. Autophagy 3. Necrosis
Q: B- Remember the main function of the following for 3.only: 1- Checkpoint during cell division 2-…
A: Introduction :- A checkpoint is a stage in the eukaryotic cell cycle where the cell considers…
Q: 11. Phagocytosis, pinocytosis, and receptor-mediated endocytosis all involve C the export of…
A: Introduction :- Pinocytosis is the process of live cells ingesting liquid droplets. Endocytosis is…
Q: b. How is the DNA information used to make proteins for ongoing cellular processes and cellular…
A: Introduction DNA is the molecular structure that is composed of a pair of polynucleotide chains and…
Q: 1: What material(s) is/are transported by the cells within the red oval?
A: Vascular plants are the most dominant type of land/terrestrial plants as they transport both water…
Q: 1. Recognize the structures in figure that represent ADP. * O A. A and B O B. A, B and C O C. A, B…
A: The nucleotides are the basic unit of nucleic acids, that means they are the basic unit of DNA and…
Q: What cell type contributes to the formation of a foreign body giant cell? Draw the cell(s) before…
A: Introduction: A macrophage is a type of white blood cell (WBC) present within the immune system of…
Q: Differntiate between cytotaxonomy and chemotaxonomy?
A: Scientific classification is the study of naming, depicting, and grouping creatures and incorporates…
Q: Why do tissues swell during inflammation? Tissues swell during inflammation because of the volume of…
A: Inflammation is a sort of immunological response that creates during the time of injury or invasion…
Q: II. CELL FEATURE OBSERVATION The following questions pertains to the features of cells. Provide the…
A: Cell is the structural and functional unit of all the individual both unicellular as well as…
Q: 10. (a) How are malignant neoplastic cells/ tissues different from normal cells/ apoptosis tissues?…
A: Introduction: Neoplastic cells are the cells which abnormally forms a mass of tissue and do not die…
Q: 3. (a) What are the different methods of cell lysis? Discuss in detail.
A: Cell disruption refers to the process of breaking cells in order to obtain the desired product,…
Q: b. Individuals with these cancers may be treated with one of the following chemotherapeutic drugs.…
A: Cancer is a complex disease in which different molecules are involved in the development of this…
Q: 17.List the cytoskeleton in the order to increasing size Name of the Protein it is cytoskeleton made…
A: The cytoskeleton is a structure that helps cells maintain their shape and internal organization, and…
Q: b. Individuals with these cancers may be treated with one of the following chemotherapeutic drugs.…
A: In cancer the uncontrolled cell division and growth occurs that it leads to the uncontrol cell…
Q: Explain the concept map depicted below. Explain how etiological agents/lifestyle/environment can…
A: Necrosis : It is the death of the body tissue . It occurs when too little blood flows through the…
Q: What is the role of epithelial-mesenchymal transition” (EMT) and MET in metastasis?
A: Epithelial mesenchymal change (EMT), a developmentally conserved formative program, has been…
Q: 9. What is cellular regeneration? How is mitosis related to this process?
A: The ability of cells to develop into the same form after an injury is called cellular regeneration.…
Q: 2- When a liver is partially resecieu occur cellular adaptation by -hyperplasia. 3- The mitochondria…
A: Introduction The mitochondrion is a double membrane-bound organelle found in most eukaryotic…
Q: 25) Identify the most correct choice: Oa) ribosomes are the membrane bound organelles responsible…
A: Introduction :- Gene therapy is the process of changing the genes in your body's cells in order to…
Q: 2. Why is it so challenging to distinguish between cells in G1 and G2 using standard microscopy…
A: Note- As per Bartleby guidelines experts are only allowed to answer one question at a time, kindly…
Q: 4. Write a short paragraph on mutations and how they may alter protein synthesis and function.
A: Introduction :- A mutation is a change in the genetic material in biology. This refers to changes in…
Q: Define cell. Name three basic cell features in all living organisms. (found both in prokaryotes and…
A: A cell is the basic membrane-bound unit that containing all the fundamental molecules of life. It is…
Q: 5) Briefly explain why the formation of a tumour can pose a risk to a person's homeostasis.
A: Cancer is a condition in which cells proliferate abnormally and infiltrate, erode, and kill healthy…
Q: 13. Compare the cells in the two photomicrographs below in terms of their shape and structure(s). А…
A: A cell consists of three parts: the cell membrane, the nucleus, and, between the two, the cytoplasm.…
Q: 38. What are the principal tissue stains used in histology and describe where and what color each…
A: The correct option is A The hematoxylin stains cell nuclei blue, and eosin stains the extracellular…
Q: At operation for removal of a suspicious mass, the lead surgeon suggested that, the mass could be a…
A: 1. Given that, in an operation, the lead surgeon suggested that the suspicious mass could be a…
Q: Please identify the G2 phase, prophase, prometaphase, metaphase, anaphase, and telophase of the…
A: During cell division, various stages that a cell undergoes are : Interphase Prophase Metaphase…
Q: Q/Choose between parentheses 1-the cell cycle included three phases are........ *…
A: The nuclear shell, endoplasmic reticulum (ER), Golgi apparatus, vesicles and other organelles…
Q: 1. Explain the importance of gluconeogenesis. Where does it occur in the cell? Which type of tissue…
A: Gluconeogenesis is the synthesis of glucose from those compounds that are not carbohydrates.…
Q: (c) Discuss the process of replication of DNA.
A: When a cell divides, DNA replicates itself via the process of replication.
Q: Describe two cells with atypical cell walls. Why is this information so important to know,…
A: Some bacteria like mycoplasma ,ricketssia shows pleomorphism due to absence of cell wall. They are…
Q: B. 1. 2. 3. 4. 5. 6. 7. 9. Which part of the cell controls cell activities and transmits hereditary…
A: The term cell is derived from the Latin word cellulae which means empty room. If an organism is made…
Q: a) What is the role of the lysosome in degrading proteins? What are the enzymes that…
A: a) Lysosomes are single membrane-bound organelles present in animal cells. Lysosomes have acidic…
Q: 8. Describe the fluid mosaic model of a cell mem the cell membrane and the internal endomemb…
A: Q8. Fluid Mosaic Model: S.J. Singer and Garth L. Nicolson proposed the fluid mosaic concept in 1972…
Q: 26) The principal functions of the ECM are ; EXCEPT a) Mechanical support for cell anchorage b) Cell…
A: Hi! Thank you for your question. As the first question posted by you is not clearly explained, we…
Q: The Cytoskeleton. Use the topic and relate the topic for initiation progression and…
A: Cytoskeleton : it is unique to eukaryotic cells . It is a three dimensional structure that fills the…
Q: Details Please answer the following prompt: How can two cells with the exact same genome obtain…
A: Hundreds of various cell kinds, ranging from immune cells to skin cells to neurons, make up the…
Q: Describe the main types of large-scale structural changes inchromosomes, and explain their potential…
A: A mutation occurs when the nucleotide sequence of a gene or chromosome changes. It can be…
Q: 15.Continuously proliferating cells include all of the following except a . Brain cells. B.Skin…
A: Human body is made up of trillions of cells. Every part of the body is made of cells. Cells compose…
Q: What is the importance of understanding the structures and functions of molecules involved in the…
A: By knowing and understanding the basics about cancer and following the recommended guidelines for…
Q: 3. List and briefly describe the steps of phagocytosis. An outlined illustration will be fine.
A: Phagocytosis is a process of a cell. Phagocytosis is done when cell want to destroy something. It…
Step by step
Solved in 4 steps
- Match the following structures with their definitions: (1) Golgi apparatus (2) mitochondria (3) peroxisomes (4) cilia (5) endoplasmic reticulum (6) cytoskeleton (7) vesicles (8) ribosomesA. sacs that contain enzymes that catalyze a variety of specific biochemical reactions B. structures on which protein synthesis occurs C. structures that house the reactions that release energy from nutrients D. a network of microfilaments and microtubules that supports and shapes a cell E. a structure that adds sugars to certain proteins and processes them for secretion F. membrane-bounded sacs G. a network of membranous channels and sacs where lipids and proteins are synthesized H. hairlike structures that extend from certain cell surfaces and wave abouMatch the following structures with their definitions: (1) Golgi apparatus (2) mitochondria (3) peroxisomes (4) cilia (5) endoplasmic reticulum (6) cytoskeleton (7) vesicles (8) ribosomes A. sacs that contain enzymes thatcatalyze a variety of specific biochemical reactionsB. structures on which protein synthesis occursC. structures that house the reactions that release energy from nutrientsD. a network of microfilaments and microtubules that supports and shapes a cellE. a structure that adds sugars to certain proteins and processes them for secretionF. membrane-bounded sacsG. a network of membranous channels and sacs where lipids and proteinsare synthesizedH. hairlike structures that extend from certain cell surfaces and wave about.Tab. 20.1. Pathological structural changes of cell organelles (1) (2) (3) (4) (5) (6) Swelling Normal (1) Change in structure Membrane changes Matrix changes (6) (5) c) e) -> (4) Mitochondria Matrix-type d) Crista-type (2) b) n Rough Endoplasmic Reticulum Z Vesiculation Ribosome lysis Vacuolation Ballooning f) (3) Type of disturbance Causes Outcomes
- 2_53392678751... material, separate from the DNA in the nucleus, and can make copies * .of themselves the lysosomes and peroxisomes. the endoplasmic reticulum. the mitochondria. the ribosomes. نقطة واحدة * :The range of the blood pH is 7.0 to 7.50 7.30 to 7.40 7.40 to 7.53 7.35 to 7.45 نقطة واحدة The . . are the rarest form of white blood cells and are involved in >63. Which of the following statements is/are true about collagen? a) It gives epithelial layers tensile strength and allows them to stretch. b) It requires hydroxylation of particular amino acids post-translationally. c) It is present in different epithelial cell types in different forms, such that it serves as a usual marker for the origin of difference cancers. d) a and c e) a, b and c1) Answer the following questions about a Vegetarian diet: a) If applicable, what specific tissue or organelle would be affected by the diet. If no research is available, hypothesize which tissue or organelle may be affected and why. b) Which nutrient (macro or micro) is the focus of this diet? c) List the foods that would contain the nutrients that are the main focus of the diet.
- Mention three proteoglycan that form he major component of connective tissue.In addition to vitamin A (retinoic acid), which other fat-soluble vitamin has been shown to make lysosomal membranes more unstable and vulnerable to rupture (when the cytosol is acidic)? vitamin E (in the form of a-tocopheryl succinate) vitamin B12 (in the form of cyanocobalamin) vitamin C (in the form of ascorbic acid) vitamin B2 (in the form of riboflavin) vitamin B1 (in the form of thiamine)Give the respective structural descriptions and functions of the following: 1. Cell Membrane 2. Nucleus 3. Nucleolus 4. Smooth Endoplasmic Reticulum 5. Rough Endoplasmic Reticulum 6. Nuclear Membrane 7. Mitochondria 8. Golgi Apparatus 9. Cytoskeleton
- Give the specific terms for the following:(a)Cluster of ribosome’s found in cytoplasm(b)Extensive in folding to the inner membrane of mitochondria.(c) Stacks of closely packed thylakoids(d)Stalked particles on the inner membrane of mitochondria.100. Hemocytes are stem cells which become plasma cells of the White Blood Cell System. These cells produce a type of proteins called antibodies. These antibodies attack viruses and bacteria. Such cell products are: a) synthesized by the ribosomes, b) synthesized into the endoplasmic reticulum, c) transported by vesicles into the Golgi apparatus, d) released by the Golgi apparatus into the blood by exocytosis e) all of these steps occur.5- The function of carbohydrates in the cell membrane is primarily: a) Providing structural integrity b) Assisting in the diffusion of water-soluble substances c) Serving as receptor sites for hormones d) Forming glycoproteins 6- Which of the following cellular structures is responsible for producing energy? a) Nucleus b) Golgi apparatus c) Mitochondria d) Endoplasmic reticulum 7- The region within the cell that surrounds the nucleus is called: a) Cell membrane b) Cytoplasm c) Golgi apparatus d) Endoplasmic reticulum. 8- Which of the following cellular structures is responsible for storing genetic information? a) Nucleus b) Ribosome c) Lysosome d) Vacuole 9- The organelle that is responsible for protein synthesis in a cell is: a) Nucleus b) Mitochondrial c) Ribosome d) Golgi apparatus