Q: Single celled; found mostly in extreme environments This domain includes most of the single- celled…
A: Introduction Most all life on the globe begins as a single-cell organism since the cell is the…
Q: This diagram shows a small part of a food web. Notice that the food web contains multiple food…
A: A consumer-resource system of the food chain is an important aspect to maintain the balance of our…
Q: why is fluid mosaoc model called "fluid mosaic model" ?
A: Introduction :- Different facts on the composition of functional cell membranes are explained by the…
Q: Consider the graph below. This is an example of whatkind of natural selection? O Directional…
A: Evolution is a steady phenomenon which cause transformation in life from much simple to more…
Q: Cell membranes are described to be fluid mosaics. What does that mean? Are all membranes components…
A: The creators of the fluid mosaic model are S.J. Singer and Garth L. Nicolson. According to this…
Q: 86 Which of the following is NOT associated with the prokaryotic cell memb is selectively permeable…
A: The membrane which allow the passage of solvent molecules but do not allow the passage of solute…
Q: 1.It is known that there is an ionic asymmetry between inside and outside of the cells membrane.…
A: MRP- Membrane resting potential It refers to the voltage across a given cell membrane during the…
Q: What is the function of NEU?
A: An oncogene is a mutated gene with the ability to cause cancer.
Q: Rank the following taxonomic groups, from greatest global species diversity (1) to least global…
A: How many species are there on Earth? Conservative and scientific estimates made by Robert May place…
Q: Given the following traits that the parents have, assign the letters H for hair type, E for eyelids,…
A: A trait is characteristic feature that is unique to particular individual. A trait is represented by…
Q: Aside from skeletal structural similarities, what other commonalities among organisms might be…
A: Evolution is the process of accumulation of genetic variations in individuals that lead to the…
Q: 3. In the absence of the channel of straight connection the activity of a contour of biological…
A: Regulation In biology, regulation means to control the process that take place inside an organism.
Q: compare eukaryotic and prokaryotic cells
A: Prokaryotic And Eukaryotic Cells Prokaryotic cells, which comprise bacteria and blue green algae,…
Q: 2. What link of a contour of biological regulation provides possibility of regulation "on a…
A: Introduction The contour of biological regulation:- It is a way for information processing &…
Q: Label whether the following are genotypes or phenotypes: a. Aa b. Tall plants c. BB d. Abnormal cell…
A: Introduction The study of genes and heredity, or how particular characteristics or traits are…
Q: The _____ direct the cells' growth and
A: Answer is Nucleus It is involved in directing the cell towards growth and reproduction. It is a…
Q: 64 65 calx A pure culture contains only A. one species of microorganism. B. bacteria. C. a variety…
A: Culture:- it is a method of multiplying the microbes as well as eukaryotic cells in a appropriate…
Q: Among the different fields or disciplines of biochemistry, which do you think is the most applicable…
A: Introduction Biology is a vast topic that can be discussed in depth and it would turn into an essay.…
Q: A male fruit fly, heterozygous for both vestigial wings and ebony body, is crossed with a female…
A: Introduction An expression of a trait, which could be morphological, behavioral, molecular, etc., is…
Q: Discuss primate evolution before Sahelanthropus.
A: Man is the result of evolution. As a result, human evolution is intrinsically related to the origin…
Q: In aseptic technique, What will/may happen if you open a solid plate and not pass the inoculating…
A: Sterilization The method to remove or kill bacteria completely from any place, part, object or…
Q: Discuss the effects of isotonic, hypotonic, and hypertonic environments on red blood cells and plant…
A: Osmosis is the net movement of water across a semipermeable membrane.
Q: What is the general composition of lysosomes? How are they formed? How do they obtain low pH? Why is…
A: Lysosomes are cell organelles found in the eukaryotic cells of animals. In plants, these are very…
Q: Which of the following is true about nucleosides and nucleotides? Choose all that apply. A…
A: Nucleosides and nucleotides are structural subunits of nucleic acids such as DNA and RNA.…
Q: Explain how Alexander Fleming's discovery of the first antibiotic (Penicillin) made an impact on…
A: Introduction: The Scottish researcher Sir Alexander Fleming is credited with discovering penicillin…
Q: Give an example in your daily activities that illustrates each level of organization of ecological…
A: The "niche" of an organism is characterized by the set of conditions, resources, and interactions it…
Q: What is the importance of the aseptic technique?
A: Microbes are the tiny , microscopic organisms that cannot be visualise as such through naked eyes .…
Q: If you can please fill out the chart
A: Dyes are used to improving the resolution during gel electrophoresis. Nucleic acid staining dyes…
Q: Explain why brain edema might occcut in people with servere hyponatremia and consuming too much…
A: INTRODUCTION Brain edema This is the over accumulation of fluid in the brain.
Q: was es The scientists develop a computer simulation that will let them test how changes to the…
A: Introduction Increased genetic diversity leads to increased chances of survival of a species. This…
Q: 2. Give an example in your daily activities that illustrates each level of organization of…
A: Explanation: 1. Individual: I am an individual human being, and I am affected by my environment.…
Q: Name three disadvantages of sexual reproduction (relative to the asexual alternative). Name one…
A: Reproduction is the process by which new offsprings are produced through the process of vertical…
Q: the Highest P... 2019 Summer Inter... Match each of the parts of a eukaryotic (specifically, human)…
A: As per the hierarchy of life, cell is the smallest entity that consists life of its own. It is…
Q: salinity
A: Salinity: It is defined as the is the saltiness or amount of salt dissolved in a body of water…
Q: How did life likely originate in the planet? Choose ONLY ONE. - Biogeochemical theory - Special…
A: Introduction The natural process through which life has developed from non-living matter, such as…
Q: cell membrane endomembrane system cytoskeleton enzymes mitochondria nucleus [Choose ] [Choose ]…
A: Eukaryotes - Eukaryotes are organisms whose cell contains membrane-bound cell organules like the…
Q: How is quorum sensing related to virulence of microorganisms? How does this advances our…
A: Introduction Quorum sensing is seen in prokaryotes. It is a response and stimuli system. Several…
Q: Arrange and match in chronological order the pathway of water in syconoid sponges: Dermal ostium…
A: Sponges Sponges belong to the kingdom porifera also knows as pore bearing animals.
Q: What is the role of the mannose-6-phosphate (M6P) group? • What happens when M6P cannot be…
A: Mannose-6-phosphate is a molecule bound by lectin in the immune system. M6P is converted to fructose…
Q: Describe and label a nematocyst and the cell containing it. Describe how nematocysts fire. How does…
A: Nematocysts are characteristic features of Cnidarians. These specialized cells are used for…
Q: The largest cycloneuralians are also the only ones with external fertilization. Which phylum is…
A: * Cycloneuralians belongs to the clade of ecdysozoan animals which consists of Scalidophora and…
Q: A bacteria having a generation time of 30 minutes will undergo 6 cell division/hr. During 6 hrs of…
A: Cell culture provides mechanisms for the investigation of cell physiology and fundamental…
Q: 7. At electrical current irritation of the ventral roots of a spinal cord it is impossible to…
A: Introduction The nervous system acts as a control system that consists of highly specialized cells…
Q: After eight years of married life, during which time she had frequent intercourse with her husband…
A: The father of the first child with OO +/- can be either the husband or the lover. The father of…
Q: In allosteric activation_ O the substrate only binds to the low affinity enzyme. the effector binds…
A: Allosteric In enzymes whenever a molecule other than substrate bind it other than active site than…
Q: Why should we expect to find N. fosteri fossils all over the world, given that it first evolved in…
A: Pangea is a supercontinent that was surrounded by a global ocean called Panthalassa. Fossils are…
Q: Information about Aurelia Strobila. give all the details about this
A: Aurelia is commonly known as moon jellies.It belongs to the class Scyphozoa and phylum Cnidaria.
Q: Columbia CNA with 5% Sheep Blood Agar is undefined, differential and selective. Which ingredient…
A: INTRODUCTION Columbia sheep blood agar This is the 5% sheep blood agar used for the isolation of…
Q: a. A triploid cell in females b. tetrasomic cell in males c. tetraploid cell in females
A: The ploidy of a cell refers to the number of sets of homologous chromosomes present in the cell.…
Q: What is Chemical Pollution and how can we prevent it?
A: Any undesirable, harmful, poisonous particle in the air is called pollution. These particles are…
A Method of Consolidating and Combining EST and mRNA Alignments to a Genome to Enumerate Supported Splice Variants.
Step by step
Solved in 2 steps
- whose properties suggest that they originated from transfer of foreign DNA into a bacterial cell.Briefly explain why RNA-seq gives more information about the transcriptome than does microarray analysis. Read Tools of Biochemistry 24A before answering this question.How many nucleotides are in the consensus coding sequence (CDS) of the KMT2D transcript? answer in numerical digits only.
- Both microarray and RNA-sequencing can study the transcriptomes. Compare microarray and RNA sequencing technique in analyzing gene with high, medium and low copy number of genes.Cap, EA1, and Sap are all genes/proteins of interest in this study. For each gene, what gene product is encoded and where is the gene (the literal DNA sequence) located physically in the cell? I need help fimiding this in the artticle and answer as short as possible https://www.ncbi.nlm.nih.gov/pmc/articles/PMC106848/Identical twin brothers begin life with identical genomes andepigenomes. How will this circumstance change with age?Suggest how these changes could be used as a forensic tool.
- Briefly explain why RNA-seq gives more information about the transcriptome than does microarray analysis.gene cloning of amplified gene with enzmesBelow is a portion of a bacterial chromosome that contains a gene. The promoter region and the +1 base pair are indicated, as well as the polarity of the two DNA strands. Analyse this DNA fragment and answer the questions 1-5 that follow. +1 -10 -35 3' TTGCATCCGAAACGTACGATCGATESGCCGACTTATTACGATCGGACTACTGCGTCGTAGC5' 5' AACGTAGGCTTTGCATGCTAGCTAGCCGGCTGAATAATGCTAGCCTGATCACGCAGCATCG3' ... ... Provide a brief statement in the space provided 1. What is the name if the TATTA sequence at -10 ? 2. What is the purpose of the -10 and -35 sites 3. What do you understand by the +1 site 4. Write the letters for the bases of the first 6 nucleotides of the mRNA molecule transcribed from this gene. Indicate the 5' and 3' end in your answer
- See the attachment and answer the following parts of the question: A) If the binturong genome is 2.87 x 109 base pairs, and the "highly repetitive DNA" fraction is composed entirely of copies of sequence 5'ATGGTCC3' and its complement, how many copies of this sequence are present in the binturong genome? B) Briefly explain, in your own words, why the fraction of the binturong DNA fragments that reannealed relatively slowly took so much longer to renature than the other DNA fragments. C) If you took more of the same randomly generated 1000 bp fragments of binturong DNA (the same sample that you used in the equilibrium density gradient centrifugation experiment described in part a and the C0t curve described in part b of this question) and used them as a sample in agarose gel electrophoresis, how many bands would you expect to find in the gel when you turned off the current and stained the gel with ethidium bromide? Briefly explain why you would predict that number of bands.Give only typing answer with explanation and conclusion Information: 1_Green Fluorescent Protein 2_nucleotide sequence, Amino acid sequence, and primers are obtained. 3_PCR protocol already described 4_bp has been calculations and estimated agarose gel image already designed. Questions: How do you analyze whether your target protein is expressed by E. coli cells. Explain your analysis method in detail and give information about the results you expect (in detail please)Titled “Techniques utilized to generate a genetically engineered organism and confirm gene disruption.” a. In the table, indicate with an "x" if the reagent or technique applies to DNA, RNA, and/or protein. You can have more than one "x" in each row or none at all.