A male has a particular X-linked recessive genetic disorder. His partner is normal, but her father had the disorder. What is the chance that their sons will have the disorder? Select one: O a. 50% O b. 0% O c. O d. impossible to determine from the information given. О e. 100% 25%
Q: The figure below shows the number of chromosomes observed in an actively dividing cell at each stage…
A: Cell division is defined as the process by which a cell, referred to as the parent cell, will divide…
Q: An 82 year old women was admitted to the hospital with the back and left rib pain. Radiographic…
A: The SSA test is the sulfosalicylic acid test. This is a part of the urinalysis which again the test…
Q: What advantage(s) if any, do flower clusters have over that of single flowers?
A: Flowers are the reproductive structure that are very important in case of sexual reproduction.…
Q: A KDEL sequence is necessary for ... Select an answer and submit. For keyboard navigation, use the…
A: According to certain theories, the KDEL receptor controls COPI transport. The development of COPI…
Q: Many different traits in the human race are the result of recessive or dominant inheritance. Select…
A: The unattached earlobe is dominant expression and attached earlobe is recessive expression.
Q: The amount of DNA per cell of a particular species is measured in cells found at various stages of…
A: Cell division is a phenomenon in which parent cell undergo splitting and give rise to novel cells.…
Q: Two true-breeding varieties of maize, one 11 cm high and the other 47 cm high were crossed and the…
A: Hello, thank you for the question. As you have posted a question with multiple subparts and all of…
Q: When a neuron responds to a particular neurotransmitter by opening gated ion channels, the…
A: Neurotransmitter is a chemical substance released by neurons to communicate with the target cells or…
Q: The only protein bound to the labeled hormone is identified in the new clear fraction. Hormone X is…
A: Hormones are the chemical compounds which are secreted from the respective endocrine glands. These…
Q: How was the normal range of phenotypic variation within and between groups so different than it is…
A: The physical manifestation, or traits, of that attribute, is referred to as phenotype. It describes…
Q: Provide a explantion and diagram of the Intracellular mechanism of smooth muscle relaxation via…
A: Introduction: Our body have different kinds of nervous system such as central nervous system…
Q: With which kind of antibiotic (static or cidal) would you expect the MIC and MBC to be about the…
A: Introduction : MIC is the minimum inhibitory concentration of the antimicrobial agents to inhibit or…
Q: Which statement best describes the interaction that occurs as a result of the bindi ligand to a…
A: Option- B
Q: The following DNA sequence is found on a chromosome in rice plants: 5’…
A: Given DNA sequence: 5’ ACCTTGCTCACATGTGGCGTACCTTTCCGTCTATCTGAACAC 3’ Since, this is the…
Q: What is the role of NAD+ and FAD in the breakdown of glucose?
A: INTRODUCTION Glucose Glucose is a simple sugar molecule that act the main source of energy in our…
Q: # File Arial Home 8 Insert Type here to search Draw B 1 U Layout Review ab X₂ View x AA EEZIE (0)…
A: Introduction Meiosis: It is the type of division of cell in which two stages results in four…
Q: All of the following proteins function during nucleotide excision repair, EXCEPT: A. DNA pol B. Uvr…
A: INTRODUCTION • Nucleotide excision repair (NER) is a particularly important excision mechanism that…
Q: Using the Butterfly stroke in swimming as an example (see video); What is the significance of having…
A: Butterfly stroke It refers to a swimming stroke that is swum on the chest. In this stroke, both arms…
Q: Draw a simple schematic of a neuron and label its parts. Where does “information” usually go in and…
A: Neurons are the nerve impulse generating and conducting cells in the nervous system that are…
Q: In 1988, neurologists in Australia reported the existence of identical twins who had developed…
A: Myoclonic epilepsy is a type of epilepsy that is characterized by myoclonic seizures. Myoclonic…
Q: Why do some viruses infect only animals and others only humans? How do viruses overcome these…
A: Viruses are ultrasmall pathogenic pathogens which can only grow inside a host cell. The viruses can…
Q: The regulation of the blood glucose level represents an important feedback loop in the hu- man body.…
A: The mechanism through which the body keeps blood glucose levels, particularly glucose…
Q: Before we conclude that mirror neurons help people imitate, which of the following should research…
A: Mirror neurons are a particular sort of brain cell which reacts the same way when we carry out an…
Q: 4. In a given population of 1000 individuals, the allele frequencies are a = 0.4 and A = 0.6. What…
A: Given - Population size - 1000 Frequency of occurence of dominant allele (A) - 0.6 Frequency of…
Q: According to Jonathan Drori, angiosperms evolved a "more intelligent" way of reproducing by…
A: Angiosperms are the largest groupof flowering plants on earth. and it is most diverse part of land…
Q: Which is a structural gene? A. The gene that encodes ß-galactoside permease OB. Allolactose OC. The…
A: Operon is the gene regulatory mechanism in prokaryotes that regulates many genes that are involved…
Q: Which of the following correctly describes mitosis? A It regulates the transfer of genetic…
A:
Q: the two ribosomal subunits did not come together during translation, and the small subunit attempted…
A: Translation is the process where codons in the mRNA are used to generate a polypeptide.
Q: Draw and label the different steps, including the DNA, RNA’s, the enzymes involved, in translation…
A: Introduction DNA is a self replicating molecule. mRNA is produced from DNA by a process called…
Q: The Multiregionalism model of modern human origins hypothesizes that____. a. some features of…
A: The evolution of humans is based on different hypotheses. There are two hypotheses which are more…
Q: Imagine a gene (locus) with four different alleles (alleles are variants of a gene) for fur colour,…
A: Given that there are four alleles for a single gene - Fa, Fb, Fc, and Fd. Each individual has two…
Q: My Planet is called _____________________. It is located in the ___________________. The weather is…
A: Astrobiology It is the study of life in the universe. Understanding life and the nature of the…
Q: Use the concept of an LD50 value. The LD50 of a substance is the dosage that would be lethal to 50%…
A: Acute toxicity refers to the adverse effects of a tested chemical substance that is the outcome of…
Q: Give an example of an aerobic traning exercise program using the FITT Principle
A: A helpful tool for tracking daily workout regimen is the FITT Principle. The letter F indicates…
Q: THIS IS BABY's CORD BLOOD SAMPLE. The letters on the cell represent BABY's RBC antigens, those…
A: The ABO blood group system is used to denote the presence of one, both, or neither of the A and B…
Q: Armadillos spend a lot of time digging in soil find insects and plant roots to eat as well as make…
A: Digging is considered as a major type of activity in armadillos life because its their habit to dig…
Q: Which female could be the mother of the child and why? Which male could be the father of the child…
A: There are several ways to identify the mother of a child from VNTR loci. One way is to look at the…
Q: (a). Four of these energy-rich molecules are produced in glycolysis: (b). Glucose is split into two…
A: Introduction In order to get chemical energy for cellular processes, organisms require oxygen to…
Q: This is an image of a lily flower. Based on your reading, please click the part of the flower where…
A: Sexually reproducing organisms produce male and female gametes. The fusion of male and female…
Q: Which among the following is not a raw material of light dependent reactions of photosynthesis?…
A: Please follow step 2 for detailed explanation.
Q: In the kidney, inhibition of glucose reabsorption causes glucose clearance to do which of the…
A: Introduction The word renal is very much related to Kidneys. The main function of Kidneys is to…
Q: Q9. Here is a hypothetical evolutionary tree showing domestic and wild pigeon populations. If this…
A: Introduction Phylogenetic tree is also known as dendrogram. It is a diagram that shows the…
Q: According to mitochondrial DNA Homo neanderthalensis and modern Homo sapiens diverged around____. a.…
A: Though genetically distant from contemporary humans, neanderthals are more linked to us than chimps…
Q: The following mRNA is found inside a yeast cell: 5’ ACUAUGCGAGAAAGCAACUACGCCUAA 3’ Write the…
A: Given mRNA strand: 5’ ACUAUGCGAGAAAGCAACUACGCCUAA 3’ mRNA is formed by transcription from a DNA…
Q: What is precocene. 2. Different sources of precocene (plant and chemical). 3. Source of…
A: Precocene is members of Chromenes and an aromatic ether having chemical formula C12H13O2. it is a…
Q: Use the Hill Equation to determine the fractional saturation of hemoglobin in equilibrium with blood…
A: The phrase "fractional saturation" relates to the FO2 Hb, that is the portion of total haemoglobin…
Q: A human STR locus contains a tandem repeat (TAGA), where n may be any number between 5 and 15. How…
A: Introduction The traits of a living organism are determined by its genotype. These traits are…
Q: What happens during the carbon fixation stage of the Calvin Cycle (light-indepedent reactions)?…
A: The Calvin cycle or light independent reactions follows three essential steps. These stages are…
Q: Which mammal has forelimbs best optimized for speed? Enter only the one-word common name of the…
A: Many species depend on quick movement to capture prey and flee from predators, which is essential…
Step by step
Solved in 2 steps with 1 images
- Redgreen color blindness is an X-linked recessive disorder in humans. Your friend is the daughter of a color-blind father. Her mother had normal color vision, but her maternal grandfather was color-blind. What is the probability that your friend is color-blind? (a) 1 (b) (c) (d) (e) 0A couple was referred for genetic counseling because they wanted to know the chances of having a child with dwarfism. Both the man and the woman had achondroplasia (MIM 100800), the most common form of short-limbed dwarfism. The couple knew that this condition is inherited as an autosomal dominant trait, but they were unsure what kind of physical manifestations a child would have if it inherited both mutant alleles. They were each heterozygous for the FGFR3 (MIM 134934) allele that causes achondroplasia. Normally, the protein encoded by this gene interacts with growth factors outside the cell and receives signals that control growth and development. In achrodroplasia, a mutation alters the activity of the receptor, resulting in a characteristic form of dwarfism. Because both the normal and mutant forms of the FGFR3 protein act before birth, no treatment for achrondroplasia is available. The parents each carry one normal allele and one mutant allele of FGRF3, and they wanted information on their chances of having a homozygous child. The counsellor briefly reviewed the phenotypic features of individuals with achondroplasia. These include facial features (large head with prominent forehead; small, flat nasal bridge; and prominent jaw), very short stature, and shortening of the arms and legs. Physical examination and skeletal X-ray films are used to diagnose this condition. Final adult height is approximately 4 feet. Because achondroplasia is an autosomal dominant condition, a heterozygote has a 1-in-2, or 50%, chance of passing this trait to his or her offspring. However, about 75% of those with achondroplasia have parents of average size who do not carry the mutant allele. In these cases, achondroplasia is due to a new mutation. In the couple being counseled, each individual is heterozygous, and they are at risk for having a homozygous child with two copies of the mutated gene. Infants with homozygous achondroplasia are either stillborn or die shortly after birth. The counselor recommended prenatal diagnosis via ultrasounds at various stages of development. In addition, a DNA test is available to detect the homozygous condition prenatally. What if the couple wanted prenatal testing so that a normal fetus could be aborted?A couple was referred for genetic counseling because they wanted to know the chances of having a child with dwarfism. Both the man and the woman had achondroplasia (MIM 100800), the most common form of short-limbed dwarfism. The couple knew that this condition is inherited as an autosomal dominant trait, but they were unsure what kind of physical manifestations a child would have if it inherited both mutant alleles. They were each heterozygous for the FGFR3 (MIM 134934) allele that causes achondroplasia. Normally, the protein encoded by this gene interacts with growth factors outside the cell and receives signals that control growth and development. In achrodroplasia, a mutation alters the activity of the receptor, resulting in a characteristic form of dwarfism. Because both the normal and mutant forms of the FGFR3 protein act before birth, no treatment for achrondroplasia is available. The parents each carry one normal allele and one mutant allele of FGRF3, and they wanted information on their chances of having a homozygous child. The counsellor briefly reviewed the phenotypic features of individuals with achondroplasia. These include facial features (large head with prominent forehead; small, flat nasal bridge; and prominent jaw), very short stature, and shortening of the arms and legs. Physical examination and skeletal X-ray films are used to diagnose this condition. Final adult height is approximately 4 feet. Because achondroplasia is an autosomal dominant condition, a heterozygote has a 1-in-2, or 50%, chance of passing this trait to his or her offspring. However, about 75% of those with achondroplasia have parents of average size who do not carry the mutant allele. In these cases, achondroplasia is due to a new mutation. In the couple being counseled, each individual is heterozygous, and they are at risk for having a homozygous child with two copies of the mutated gene. Infants with homozygous achondroplasia are either stillborn or die shortly after birth. The counselor recommended prenatal diagnosis via ultrasounds at various stages of development. In addition, a DNA test is available to detect the homozygous condition prenatally. What is the chance that this couple will have a child with two copies of the dominant mutant gene? What is the chance that the child will have normal height?
- A couple was referred for genetic counseling because they wanted to know the chances of having a child with dwarfism. Both the man and the woman had achondroplasia (MIM 100800), the most common form of short-limbed dwarfism. The couple knew that this condition is inherited as an autosomal dominant trait, but they were unsure what kind of physical manifestations a child would have if it inherited both mutant alleles. They were each heterozygous for the FGFR3 (MIM 134934) allele that causes achondroplasia. Normally, the protein encoded by this gene interacts with growth factors outside the cell and receives signals that control growth and development. In achrodroplasia, a mutation alters the activity of the receptor, resulting in a characteristic form of dwarfism. Because both the normal and mutant forms of the FGFR3 protein act before birth, no treatment for achrondroplasia is available. The parents each carry one normal allele and one mutant allele of FGRF3, and they wanted information on their chances of having a homozygous child. The counsellor briefly reviewed the phenotypic features of individuals with achondroplasia. These include facial features (large head with prominent forehead; small, flat nasal bridge; and prominent jaw), very short stature, and shortening of the arms and legs. Physical examination and skeletal X-ray films are used to diagnose this condition. Final adult height is approximately 4 feet. Because achondroplasia is an autosomal dominant condition, a heterozygote has a 1-in-2, or 50%, chance of passing this trait to his or her offspring. However, about 75% of those with achondroplasia have parents of average size who do not carry the mutant allele. In these cases, achondroplasia is due to a new mutation. In the couple being counseled, each individual is heterozygous, and they are at risk for having a homozygous child with two copies of the mutated gene. Infants with homozygous achondroplasia are either stillborn or die shortly after birth. The counselor recommended prenatal diagnosis via ultrasounds at various stages of development. In addition, a DNA test is available to detect the homozygous condition prenatally. Should the parents be concerned about the heterozygous condition as well as the homozygous mutant condition?One type of chronic porphyria is X-linked dominant. A woman with chronic porphyria whose father was normal has children with a normal man. What is the phenotypic ratio of their children? Oa. 1 female with porphyria: 1 normal male Ob. all of their children have porphyria O c 2 normal females: 1 normal male: 1 male with porphyria O d. 1 nomal female: 1 female with porphyria: 1 normal male: 1 male with porphyria O e. 2 females with porphyria: 1 male with porphyria: 1 normal male Of. all children are normal Next page Follow LIO MacBook Air DII F9 FB F7 80 F5 F3 esc F2 % 2# $ 8 6 4 このD. If a man is color-blind, which parent did he inherit the gene from? Explain your answer. E. Which parent does a man get all his x-linked genes from? F. If a woman is color-blind, what do you know about the genotypes and phenotypes of her parents? G. Are men more likely than women to get a genetic disease which is x-linked and dominant? Are they more likely to get a disease that is x-linked and recessive? Explain your answers. H. Can a man with normal color vision have a colorblind daughter? Explain your answer. I. Which parent determines the sex of a child?
- A male has a particular X-linked recessive genetic disorder. His partner is normal, but her father had the disorder. What is the chance that their sons will have the disorder? Select one: O a. 50% O b. 0% O c. 100% O d. impossible to determine from the information given. O e. 25%An individual with 46, XX genotype is diagnosed with Duchenne-type Muscular Dystrophy, a recessive X-linked disorder. Genetic tests confirm that this individual is a heterozygote for this disorder. Briefly, but specifically, explain how it’s possible that they are showing symptoms of this disorder.In this part, you will work out on X-linked traits. Remember that males have only one X chromosome and females have two. For X-linked recessive, use the following designations: XA= normal Xa= the trait (a genetic disease or abnormality) For X-linked dominant, use the following designations: XA= the trait (a genetic disease or abnormality) Xa= normal Determine if the pedigrees below can be for a trait that is X-linked recessive. Write the genotype next to the symbol for each person in the pedigree below. A. Is it possible that this pedigree is for an X-linked recessive trait? B. What can you conclude about the children of mothers affected with an X-linked recessive characteristic? C. What can you conclude about the father of an affected female?
- A man who has color blindness and type O blood has children with a woman who has normal color vision and type AB blood. The woman’s father had color blindness. Color blindness is determined by an X-linked gene, and blood type is determined by an autosomal gene. a. What are the genotypes of the man and the woman? b. What proportion of their children will have color blindness and type B blood? c. What proportion of their children will have color blindness and type A blood? d. What proportion of their children will be color blind and have type AB blood?I. White eye cross White eye color is a recessive trait found on the X chromosome. Also called Sex-linked. This is called sex-linked. Gene symbols Xw White eye color X normal red eye color Y it’s a boy The parents were White eye color female XwXw and red eye color male XY Diagram of P1 cross: You are crossing XwY and XXw (figure out the phenotype) Diagram of F1 cross: Give expected F2 phenotypic ratio: Give expected F2 genotypic ratio:Match the chromosome disorder to its descriptionin the key. Jacobs syndrome a. female with undeveloped ovaries and uterus, unable to undergopuberty, normal intelligence, can live normally with hormonereplacementb. XXY male, can inherit more than two X chromosomesc. male or female, mentally impaired, short stature, flat face, stubbyfingers, large tongue, simian palm creased. XXX or XXXX femalee. caused by nondisjunction during spermatogenesis