A lilP mutant called lilPXS is isolated that produces a truncated polypeptide of only 6 AA in length. Describe a single basepair DNA change that would lead to this truncated version of the protein. Multiple options are possible (100 words max.)
Q: What would you change about this experimental procedure in order to make biodiesel instead of soap?
A: Biodiesel is an environmentally friendly fuel derived from vegetable oils, animal fats, or recycled…
Q: what happens when there is a defiency of complex dietary carbohydrates in the body? what happens if…
A: Carbohydrates: Carbohydrates are one of the three macronutrients found in food, alongside protein…
Q: Contrast what is going on in the heart with each part of a blood pressure reading (like, 120 over…
A: There are teo main phases in the functioning of heart. These are systole and diastole. Together,…
Q: In 5 or more sentences explain how the severe weather event created ecological disturbances that…
A: Introduction : Many ecological disturbances, including temperature changes, modifications to the…
Q: 1. Write the summary chemical equation for photosynthesis.
A: INTRODUCTION- Photosynthesis is the process by which plants, algae, and some bacteria convert light…
Q: When a single recombination event occurs between a normal chromosome and a chromosome with a…
A: Chromosomal rearrangement is a term used to describe any structural change that occurs in the…
Q: Nail-patella syndrome gene is 10 map units from the I gene that determines the ABO blood type on…
A: Genes are the basic unit of hereditary. When two genes are present in the same chromosome, it is…
Q: What were some major accomplishments that percy lavon julian did before he died. For example,…
A: Percy Lavon Julian was a pioneering African American chemist who made significant contributions to…
Q: Fill in the letter (a, b, c, d, or e) showing the locations where each of the following enzymes…
A: DNA replication is the mechanism by which a cell duplicates its genetic material. It is a…
Q: What are some tangile solutions to how combat how climate change is affecting the healthcare system
A: Weather condition which is expected in a particular region in a particular period of time is termed…
Q: Eukaryotic cells coordinate dna replication with cell cycle so that the genome is copied once per…
A: Introduction :- Eukaryotic cells have a complex and highly regulated DNA replication process that is…
Q: What is the methodology in RNA Biology | Taylor & Francis Online
A: The question asks about the methodology used in RNA Biology. It wants to know the techniques and…
Q: Some strains of Escherichia coli bacteria have acquired the ability to produce the harmful Shiga…
A: Bacteria can be harmful because they can produce toxins that can cause illness or even death. These…
Q: https://moodle.swarthmore.edu/pluginfile.php/83002/mod_resource/content/0/Scheper-Hughes,%20Lock-%20…
A: INTRODUCTION The article "The mindful body: A prolegomenon to future work in medical anthropology"…
Q: Which types of mutations cause (1 word) a. Increase amount of genetic material in particular…
A: a. Duplication mutations: These mutations result in the duplication of a segment of DNA, which can…
Q: Contrast pulmonary and systemic circulation.
A: Introduction : The circulation in animals is divided into two circuits. Hence, the blood is…
Q: Match the type of pathogen with the correct description. Prions Virus Protozoans Bacteria and…
A: Pathogens are varied in terms of taxonomy. Pathogens include bacteria and both single- and…
Q: Phenylalanine (Phe): Codons 5'-UUU-3' and 5'-UUC-3' Cysteine (Cys): Codons 5'-UGU-3' and 5'-UGC-3'…
A: Introduction The genetic code is made up of a set of codons, which are sequences of three…
Q: Why did the researchers discover enrichment for ARGs that confer resistance to antibiotics that were…
A: The discovery of enrichment for antibiotic resistance genes (ARGs) that confer resistance to…
Q: As you passed through the left leg, you traveled through an extremely narrow passageway called As…
A: Introduction The cardiovascular system, also known as the circulatory system, is a complex network…
Q: Describe the sharks' skin coloration, scales, skeleton, appendages, body form, and position of its…
A: Introduction :- Sharks are a diverse group of fish that have been around for over 400 million years,…
Q: richard thompson is a 35 year old male whose blood pressure was consistently tested at approximately…
A: Introduction :- Asthma is a chronic respiratory condition characterized by inflammation and…
Q: A pedigree lists a father as the proband for a genetic disorder that he inherited from his mother.…
A: Inherited disorders are genetic conditions that are passed down from parents to their offspring…
Q: Ms. Simons, Ms. Simpson, and Ms. Simple all entered the same hospital and gave birth to baby girls…
A: There are four types of blood: A, B, AB, and O. The presence or absence of two antigens (A and B) on…
Q: Genes L and M are 10 map units apart. You cross a homozygous LLMM with an Ilmm, and then testcross…
A: Genetic distance refers to the degree of genetic difference or variation between two or more…
Q: there can only be one answer
A: A genus is a taxonomic rank used in biological classification that groups together one or more…
Q: Oxygen Requirements of Microorganisms. Predicted Results of: -Clostridium Sporogenes -Pseudomonas…
A: Introduction Bacteria are unicellular, microscopic organisms that belong to the domain of…
Q: What is a trichrome stain? How can it be used to identify protozoan?
A: Staining in microbiology refers to the process of coloring microbial cells or structures using a…
Q: monomer disaccharide glucose cell wall energy structure glycosidic bond isomer cell-to-cell…
A: INTRODUCTION OK Now let's start as this is an discussion based question in which ,I was asked to…
Q: Part 1 a) The zygote that is formed after fertilisation divides rapidly during the first 2 weeks of…
A: Zygote: A zygote is a single cell that forms when a sperm cell fertilizes an egg cell during sexual…
Q: Topic: My 600 life Ib life In a paragraph write your thoughts on their stories. What nutrition…
A: Introduction Nutrition refers to the study of how food and nutrients impact human health and…
Q: Use the following information to answer the next question Giraffes and other hoofed animals,…
A: Note: According to bartleby guidelines only first question is to be answered. Please upload others…
Q: Normal pigmentation in humans is completely dominant to albinism. A couple who are both carriers for…
A: Albinism is a group of inherited genetic disorders characterized by a lack of melanin, the pigment…
Q: milk solid-non-fat content meaning
A: Milk solids non-fat (MSNF) is a critical indicator of milk quality and composition because it…
Q: Give bioethical principles that was violated or upheld in conducting clinical trials
A: A clinical trial is a research study that involves human participants to evaluate the safety and…
Q: Investigation: Suppose you accidentally introduce a small plant-eating beetle into your…
A: The above question is related to the subject of ecology, specifically the interactions between…
Q: Plasmids that generate blunt ends after restriction enzyme digestion are the ones most effective for…
A: Crop and animal biotechnology have advanced thanks to recombinant DNA (rDNA) technologies. The…
Q: The frequency of the defective allele of a gene for an autosomal dominant disorder is 1/5. In a…
A: Introduction An autosomal dominant disorder is a genetic disorder caused by a mutation in a gene…
Q: Twenty-year-old Lani is in a monogamous relationship with her boyfriend. She has a hard time…
A: Introduction:- There are different types of birth control methods which are used for preventing the…
Q: 11. The following is a list of abiotic factors that would have a micro-effect on a tidal pool (rocky…
A: Answer :Water chemistry ( pH ,pollution etc) Reason: Abiotic factors are ecological elements that…
Q: Three medications that might be used to control bleeding
A: Controlling bleeding involves using medications or other techniques to stop or reduce bleeding,…
Q: Assessment criteria 2.2 Part 1: The diagram below shows six components that make up the placenta. A…
A: A temporary organ formed during pregnancy which connects the baby to the mother's uterus is…
Q: Looking at the streak plate below, is it good or poor technique (it may look slightly different…
A: The streak plate method is a laboratory approach to isolating pure culture of bacterial cells from a…
Q: A mutation in gene changes a base pair from at to gc this change caused gene to encode truncated…
A: A mutation is a change in the genetic material of a cell that can be passed on to offspring.…
Q: Part A The bacterial gene little protein (lilP) makes a small protein of 11 animo acids (AA) in…
A: The amino acid sequence is the translated sequence of DNA sequence. During translation process, DNA…
Q: Pneumonia interferes with CO2 elimination and O₂ uptake primarily by: Slowing diffusion by reducing…
A: Pneumonia is an infection that inflames the air sacs in one or both lungs, causing them to fill with…
Q: An organism that benefits from the outside production of a compound that inhibits the competition…
A: Competition is a biological interaction between individuals or species in which they compete for…
Q: X What is a characteristic of both an alpha-helix and a beta-pleated sheet? * 0/1 Both can be…
A: Introduction : The alpha helix and the beta pleated sheet are the two most common types of…
Q: In what ways do you think increasing diversity in genetic studies can improve healthcare outcomes…
A: Genetic diversity refers to the variety of genetic material within and among populations of…
Q: Please answer fast 1. How is beaver dam construction unique? How is this technique vital to dam…
A: Answer 1) Beaver dam building is unique in that it is fully manual and involves the use of materials…
Step by step
Solved in 2 steps
- The bacterial gene shorty (sh) encodes for a small protein. The DNA sequence of the sh gene is shown below. The ORF is in CAPITAL LETTERS 5’-tataatgggcttaacaATGAGTAAAAGAGGTCCTTTACTCCGGTATCACCAATAGaaatattatttaa-3’ 3’-atattacccgaattgtTACTCATTTTCTCCAGGAAATGAGGCCATAGTGGTTATCtttataataaatt-5’ Answer the following questions: Q1. Which is the coding strand? Which is the template strand? [10%] Top-bottom. Bottom-Top. Both can be used as either coding or template for this gene.This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' (i) Draw the structure of hairpin loop that will be formed during the end of transcription. (ii) Describe the function of the hairpin loop during transcription.The bacterial gene shorty (sh) encodes for a small protein. The DNA sequence of the sh gene is shown below. The ORF is in CAPITAL LETTERS 5’-tataatgggcttaacaATGAGTAAAAGAGGTCCTTTACTCCGGTATCACCAATAGaaatattatttaa-3’ 3’-atattacccgaattgtTACTCATTTTCTCCAGGAAATGAGGCCATAGTGGTTATCtttataataaatt What is the length in AA’s of the Sh protein? Assume fMet is NOT CLEAVED [10%] 39 AA 13 AA 12 AA 21 AA
- Based on sequences A,B,C. Provide an anticodon sequence that would build this protein. Sequence ATCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTSequence BTCAGACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCAGAGATGGTCAATCTCTTAATGACTSequence CTACAAACATGTAAACACACCCTCAGTGGACCAACTCCGCAACATAAACCAAACACCGCTCGCGCCGAAAAAGATATGG3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical lines between codons to make this assignment easier to do. Which strand is the template strand? The first strand is the template strand as it going 3-5 Copy the template strand in mRNA. Label the 5’ and 3’ ends. 5' AUG UUA CCC GCU GCG CGA AGC AAA GUC UAA 3” Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins. Met-Leu-Pro-Ala-Ala-Arg-Ser-Lys-Val What do you notice about the mRNA strand compared to the non template strand of DNA? 2. What amino acid does the second codon code for on the DNA template strand? ______Assume the 6th amino acid in the strand is changed from a T to a C. What amino acid does it code for now? _______ What type of mutation is this? 3. Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would…Figure 1 is a bacterial gene (1-180). The first base to be transcribed is the base located at position 77. 45 5' TTGGT CTTGG TCGGA TTCCA GAGGA TGAAG TGTTG ACAGC GCATT 3' 3 AACCA GAACC AGCCT AAGGT CTCCT ACTTC ACAAC TGTCG CGTAA 5' 46 5 AATTG ACCTT GCTGT ATTAT AGCCA AGGAC AGATC TACGA GCATG 3' 3 TTAAC TGGAA CGACA TAATA TCGGT TCCTG TCTAG ATGCT CGTAC 5' 91 5 TGCGA ACCGC AAGCA TTCGT TCTCC TAGGC TACTC GATCC CGTAA 3' 3 ACGCT TGGCG TTCGT AACCA AGAGG ATCCG ATGAG CTAGG GCATT 5 77 90 110 135 136 5 TGATG TAGCT GATTC TGTTG AAAGG CTCCT TTTGG AGCCT TTTTT 3 3' ACTAC ATCGA CTAAG ACAAC TTTCC GAGGA AAACC TCGGA AAAAA 5 156 180 Figure 1. Illustrate how termination of transcription occurs in the gene above. (Hint: position from 156 to 180)
- what is the anticodon sequence that would build this protein? AUGUUUGUACAUUUGUGUGGGAGUCACCUGGUUGAGGCGUUGUAUUUGGUUUGUGGCGAGCGCUUUUACCAGUUAGAGAAUUACUGATranscribe the following DNA sequence into RNA, and then into amino acids 5’-GTATACTTGTGGGCCAGGGCATTAGCCACACCAGCCACCACTTTCGGATCGGCAGCC-3’ 3’-CATATGAACACCCGGTCCCGTAATCGGTGTGGTCGGTGGTGAAAGCCTAGCCGTCGG-5’What is the sequence of the mRNA transcript that will be produced from the following sequence of DNA? The top strand is the template strand, the bottom strand is the coding strand. 5’ – TCGGGATTAGACGCACGTTGGCATACCTCG – 3’ 3’ – AGCCCTAATCTGCGTGCAACCGTATGGAGC – 5’ Enter the mRNA sequence here (pay close attention to the direction of the molecule!): 5'-_____-3'
- 5'-TAGCTGATCGAATATGCGGTCTCTATCTTCGTAGACGA-3' 3'-ATCGACTAGCTTATACGCCAGAGATAGAAGCATCTGCT -5' Determine the amino acids that will be encoded by this sequence Second letter First letter U C A G U UUU Phe UUC UUA UUG Leu CUU CUC CUA CUG Leu GUU GUC GUA GUG Val UCU UCC UCA UCGJ AUU AUC lle AUA ACA AUG Met ACG CCU CCC C CCA CCG ACU ACC GCU GCC GCA GCG Ser - Pro Thr Ala A UGU UACTyr Cys UGC. UAA Stop UGA Stop A UAG Stop UGG Trp G CAC His CAA Gin CAG GAUT GAC Asp GAA AAU Asn ACC Ser AGU AAG LYS AA Glu GAGJ Oa. N-Met-Arg - Ser-Leu-Ser - Ser-C Ob. N-Met-Pro-Arg - Asn-Asp - Ser-C d. N-Met-Lys - Val-Glu-Ala-C Oc. N-Asp-Pro-Lys - Ser - Val-Ile-C Oe. N- Met-Ala-Asp-Pro-Lys - Ser-C G CGU CGC CGA CGG AGA AGG. GGU GGC GGA GGG Arg SCAO Gly U UCAG UUA DUAG Arg G Third letter 1317) Synthesis of the mRNA starts at the boxed A/T base pair indicated by the box and proceeds left to right on the sequence below. Transcribe and translate this bacterial gene. 5'-GGACCGCGGGGCAGGATTGCTCCGGGCTGTTTCATGACTIGICAGGTGGGATGACTTGGATGGAAAAGTAGAAGGTCATG-3 3'-CCTGGCGCCCCGTCCTAACGAGGCCCGACAAAGTACTGAACAGTCCACCCTACTGAACCTACCTTTTCATCTTCCAGTAC-5′ 1 -+--at - --+-- 80What’s the resulting amino acid sequence? 3’CAG TTA AGC CTC GGT TAC CAG GAT ACG GGA 5’