A fly that is heterozygous at 3 different, independent, autosomal loci (AaBbCc) is crossed to an unknown fly to yield the following progeny phenotypes in the numbers indicated: What was the GENOTYPE of the unknown fly?

A fly that is heterozygous at 3 different, independent, autosomal loci (AaBbCc) is crossed to an unknown fly to yield the following progeny phenotypes in the numbers indicated: What was the GENOTYPE of the unknown fly?

Name: A fly that is heterozygous at 3 different, independent, autosomal loci
Uploaded: 2024-03-20T06:43:04.000Z
Channel: Bartleby
Description: A fly that is heterozygous at 3 different, independent, autosomal loci (AaBbCc) is crossed to an unknown fly to yield the following progeny phenotypes in the numbers indicated:What was the GENOTYPE of the unknown fly? a b c5Ab c15АВС45аВ с5АВс15а ВС1

Curren'S Math For Meds: Dosages & Sol

11th Edition

ISBN:9781305143531

Author:CURREN

Publisher:CURREN

Chapter2: Multiplication And Division Of Decimals

Section: Chapter Questions

Problem 6.8P

See similar textbooks

Similar questions

hidden message of the cide: 5' - UGAUGAUGAUGAUGCAUGCUAACGAUUCCGCAAUGUCGAUAUCAAUACGUUGACC-3'
н но- Н о CH ОН -H ОН CH₂OH Cu2+ (aq)
C A UUU U UUC Phe UCU UCC UCA UAU UAC UAA UAG UGU Cys U UGC Stop UGA Stop Stop UGG Trp G Tyr Ser UUA UUG Leu UCG CUU C CUC CUA CCU Leu ccc CCA CCG CAU CAC CAA His CGU CGC CGA CGG Pro Arg 1st Gin CUG CAG 3rd letter AUU A AUC AUA AUG ACU AAU AAC Ser u letter C Asn AGU AGC AGA AGG lle ACC Thr ACA AAA AAG Lys Arg Met ACG GUU G GUC GUA GUG GCU GCC GCA GCG GAU GAC GAA GAG Asp GGU GGC GGA GGG Val Ala Gly Glu Not all of the following ingredients are necessary for an in vitro translation reaction. Which one would you leave out? A ssDNA template O Cell sap containing ribosomes poly(U) O 14C-Phe
Consider the mRNA sequence below. Assume that the following mRNA segment has been translated. 5'-UACCGAAUGUCU-3' Note for numbers 1 and 2: Use the three-letter abbreviation of amino acid; separate amino acids with a hyphen: do not include the stop codon. Example: ala-cys-glu 1. Using the table of the genetic code, determine the sequence of amino acids. 2. If mutation occurs by substitution of the 12th nucleotide with cytidine-5'- monophosphate, what is the resulting amino acid sequence? 3. What type of mutation occurred? Choose from same sense, missense and non-sense.
Arial 5 of 10 761 words Aav Po BIUab x₂ x² A.A. 2. Identify the following structures when given images such as the ones below: ● process of transcription process of translation ● ligands • receptor proteins (in either the cell membrane or in the cytoplasm or nucleus) ● nucleus ● ● nuclear membrane nuclear pores ● ribosomes ● ● DNA mRNA ● tRNA • growing polypeptide chain EX English (United States) AaBbCcDd Ee Normal mana | AaBbCcDdl No Spacing MacBook Air | AaBbLCUC Heading 1 Heading 2 Focus E F Title E Styles Pane I
O CH₂-O—C—CH₂(CH2)13CH3 O 11 CH-O-C-CH₂(CH₂)13CH3 1 CH, O R + -0 0-CH₂CH₂NH3 O–CH,CHÍNH, >=0
C UUU UUC Phe UUA UCU) UCC UCA UAU UAC Tyr UGU UGC Cys Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUG FLeu UCG CUU CUC CCU] СС CAU1 CAC САC His САА Gln CGU CGC Arg Leu Pro CUA CUG ССА CGA CUG J CCGJ Which of the following tRNA anticodons could theoretically base pair effectively with the codons 5'-AAU-3' and 5'-AAC-3' through third-base CAG, CGG AGU AAUASN AGC AUU AUC File A AUA ACU АСС АСА AAC FAsn AAA Ser C Thr AGA Arg A AUG Met ACG AAG Lys AGG GCU] GCC GCA GCG GGU GGC Gly GGA GAU1 GUU GUC GUA GUG Asp GACJ GAA C Val Ala A GAG Glu GGG wobble? 5'-GGG-3' OI. 5'-AUG-3' II. 5'-GUU-3' I. 5'-CAT-3' IV. 5'-AAA-3 V. Third letter UCAG UUAG A, First letter
sub= 18 help
HindII --- 5' GTC - GAC 3', HaeIII --- 5' CC - GG 3', EcoRI --- 5' G - AATTC 3' and BamI --- 5' CCTAG - G 3' 5' AGAATTCTTACGCCGGACGTACCTAGGTTTAGTCGACTC CGCCGCCCCTAGGGTCATCA 3' 3' TCTTAAGAATGCGGCCTGCATGGATCCAAATCAGCTGAGGCGGCGGGGATCCCAGTAGT 5' Number of pieces of DNA , and blunt end fragment (s), and sticky end fragment(s)
24kg= Ibs
w6 apply answer letter b
Could you please help me part d on this problem? Thank you!