Q: Letter 'f' corresponds to 3' 5' a 5' 3' e a 5' 3' 3' 5' to
A: Answer: REPLICATION OF DNA : It is the process in central dogma , where DNA is replicated in to two…
Q: G00
A: The muscular system is composed of many muscles attached to the skeleton which helps in movement of…
Q: Can you help me the name of the labels?
A: Axon is a part of the neuron, which is a structural and functional unit of the nervous system. Axon…
Q: 3 4 NH2 NH2 H-C H-oCN CH2 H-C NH2 CH2 H-C CH2 H \H H/ ター0 o. \H H/ \H H/ OH H он он он он 6. NH2 NH2…
A: DNA replication of the process by which DNA duplicates itself.
Q: Can you show me the testcross
A: Recombination Recombination is the process where a part of chromosome is broke up and bind with…
Q: hat anamoly? (CLOT 3 10 11 12 14 15 16 17 18
A: Any harmful deviation from the normal structural or functional state of an organism, generally…
Q: unscramble the words 1. E X O N T I M Y L H A ________________________ 2. N V A G S I N…
A: Electron microscopy is a tool that allows us to see tiny images of objects that would otherwise be…
Q: Isoform of hactate ole hy droganare (LDHJ prでsent in heart.
A: Isoenzymes are different from of enzyme that catalyses same biochemical reactions.
Q: Ve D
A: The brain is the mass of nerve tissue in the anterior end if an organism and is responsible for…
Q: Blank 1 options are= closed/open Blank 2 options are on second photo
A: BIK belongs to the family of pro-apoptotic proteins. BIK is mostly localized in the ER. It induces…
Q: Täil Shape Curly Straight (C') (incomplete)
A: Incomplete dominance is a very important thought within the study of genetic science. It refers to a…
Q: A B H D E E D ...... F K G B ..... H L A. M M ....
A: A microscope is an instrument that helps in observing the microscopic organisms or structures that…
Q: CH3 15 HN 9, *0-P-OCH2 5' 1' 4" 3' 2' Он LO
A: A nucleotide is an organic compound that acts as a polymer for the synthesis of DNA/RNA and it is…
Q: 中 1. 牙 13 11
A: This is the basal part of the skull. Its main parts are ethmoid, sphenoid, occipital, paired…
Q: Letter 'B' corresponds to
A: This is the Potential Energy Diagram for a reaction. It is used to predict whether the reaction is…
Q: z1 PS z2
A: Centrioles play a significant role in cell division. They help in formation of spindle fibers and…
Q: 66 a only
A:
Q: 2. 3.
A: Brain is the largest organ in the body, and coordinates most body activities. Each part of brain is…
Q: ir caured 6y- Type tyrosenemia ir caus ed óy- 9. Tyoarine Toansaminare. Fumaryl Acetogcefate…
A: Type 1 tyrosenmia is an autosomal, recessive, rare genetic disorder. In these disorders abnormally…
Q: O True O False
A: Symbiotic mutualism is a relationship between two organisms in which both the partners mutually…
Q: Can you help me identify the pointed structure thanks
A: There are various kinds of glial cells present in central (CNS) and peripheral nervous system (PNS).…
Q: NH 2 N. -0 P 0- CH2 (X) (M
A: NUCLEOTIDE Nucleoside when combined with a Phosphate forms Nucleotide. Nucleoside =…
Q: A 1 -B 2 -C
A: Answer. In phylogenetic or evolutionary studies, the most convenient way of visually presenting…
Q: 01110 0= -P-OCH₂ 51 5 HN 6 OH 3. CH₂
A: DNA is composed of deoxyribose nucleotides attached together via phosphodiester bonds. RNA is…
Q: O b. True
A: 1. So the answer for the above question is True and the reason for the above answer is given below…
Q: I letters
A: Differential stain is used is Gram stain. Gram stain uses two dyes Crystal violet and safranin. It…
Q: S-114
A: Since you have posted multiple questions, we will solve the first question for you. If you want any…
Q: Please draw a punnett square for this
A: Answer Test cross: is a cross between an individual with dominant phenotype and an individual with a…
Q: rotein after a post-trans o other changes in the o
A: There will be more conjugate base because it makes a favorable hydrogen bond to the phosphate .
Q: D) The prefix meaning within is: A) В) C) D) endo- meta- exo- cent-
A: (6): The prefix meaning within Ans (a): endo; is the correct option as endo is use for inner.…
Q: Hesel Bolgal La
A: This diagram is a diagram of spinal cord. The large white portion in the middle part is vertebral…
Q: 7 -8 1 2 3 10 11 4 5- cut 4 12 13 te
A: muscles are soft tissues. The muscle system is comprised of smooth muscle, cardiac muscle, and…
Q: This is a 320
A: The cell is very small in size. It is unable to see by naked eyes. So, scientists used microscopes…
Q: Differentiate Fischer projection and Haworth projection. Then, give at least four structural forms.
A: Fischer and Haworth projections are two types of illustration which are used to represent the 3D…
Q: This dipeptide is designated as: H3N-CH-C-NH-CH-C CH2 CH2 OH SH O Ser-Lys O Lys-Ser O Ser-Cys O…
A: An amino acid is a monomeric unit or monomer that helps to form a peptide or protein. Each amino has…
Q: А. Adenne B.- В- Cye Quanne Thynane D. C. A.
A: The free hydroxyl on the 3' carbon of the following nucleotide forms an ester bond with the…
Q: ribe adduction?
A: 1.Range of motion or ROM is the maximum amount of movement in joint or in any body part. While as…
Q: Highlights name
A: We can say that In the given image, we are shown a particular type of epithelium tissue. Epithelium…
Q: Letter 'e' corresponds to 3' 5' b. 5' 3' 5' 3' 3' 5'
A: Deoxyribonucleic acid (DNA) is the hereditary material that transmits genetic information from one…
Q: 10
A: Answer:- The picture attached to the question is of a muscle. It's a deltoid muscle.
Q: G. Н. I. J. K. L. М. N. (Choose) (Choose) (Choose) IChooco] >
A: Microscope is an instrument which is used to observe objects that are invisible to the naked Eye.…
Q: A E В 3' Y C O a. C O b. D O c. A O d. B O e. E
A: A PCR primer is a small single-stranded DNA chain of around 20 nucleotides that is complementary to…
Q: 38.Label the drawing:
A: Angiosperm plants have different parts. These are root, stem, leaves, flowers, fruits, and seeds.…
Q: Complete the calculations to find the weige NV = wt 60 Too0 0.945 60 loou
A: We can find the weight from the given equation. But as there is no unit mentioned, we are only…
Q: Monohybrid Crosses and Punnett Squares
A: The various characters expressed in an organism are controlled by the genes present in the DNA. The…
Q: 56 Identify #5 in the figure shown below. 2.
A: Operon Model: It is the basic concept that tells about the regulation of genes at transcriptional…
Q: 5.
A: It is a median section of the brain.
Q: Y 3' W
A: First of all, know the origin of replication, replication fork, leading and lagging strand. DNA…
Step by step
Solved in 2 steps
- 3. Given the following DNA molecule: 3' T 5' cG G T АА А АСТ А | | | | | | | | | | | АT G C САТ ТТТGА 5' - A 3.(b) (c) Point mutations in multiple tumor suppressor proteins have been linked to cancer. For example changes in the gene for adenomatous-polyposis-coli protein (APC gene) may result in colorectal cancer. Consider the following DNA sense strand. 3-TAC CGG TTG TGA AGC TGA ATC-5' Derive the mRNA molecule from the given DNA strand sequence above, paying attention to the polarity of the molecule. (i) (ii) (iii) (iv) Write down the polypeptide chain sequence arising from the mRNA molecule of the question above, using the table of the genetic code (Table Q1 overleaf) and indicate the C- and the N-terminus of the peptide chain. Point mutations of a cytosine (C) often lead to the dysfunction of the APC protein. Write down all possible polypeptide chains that can result from all possible DNA mutations of cytosines, disregarding a mutation in the MET/START and STOP codons. Specify which of the point mutations identified in (d) are redundant? For the given tRNA for Thrombin (Thr) write down all…Date: Class: Name: Transcription Questions Answer the following questions. 1. What bases are found in RNA? 2. What bases are found in DNA? 3. Which strand is the messenger RNA complementary to? 4. Which strand is the messenger RNA nearly identical to? 5. What proteins help to direct the RNA Polymerase to the right location? 6. The end of a new nucleotide is always added to the end of an existing strand. 7. Distinguish between the following two terms: chromosome and gene. 8. Scientists have long referred to the DNA between genes as "junk DNA". But as scientists study the genome, they discover new and unique reasons why this DNA is not really "junk". Using internet resources, research 2 functions for sections of DNA in between genes. Describe your findings below. C) 2015 Bethany Lau.
- A mutant DNA strand was transcribed then translated to proteins. a. What is the protein product of the mutant DNA strand? The sequence of the mutant strand is shown below: 5'-TGCCATAACTGTTCGTACTGGCAAATTGCC-3' 3'-ACGGTATTGACAAGCATGACCGTTTAACGG-5' b. The mutation altered the sequence of the wild type template DNA such that a degenerate codon for a basic amino acid in the wild type was converted to a non-degenerate codon resulting in the sequence for the mutant strand shown. What was the original amino acid? c. Compare the charges and pl of the mutant peptide and the normal (wild- type) peptide at physiological pH?Match Column A with Column B. transports amino acids to the site of protein synthesis has anticodon loop directs amino acid sequence of proteins contains the Shine-Delgarno sequence synthesized in the eukaryote nucleus found inside the ribosome region where the RNA binds to the DNA template…Section B: True / False (5 marks) 1. Primase has a DNA dependent RNA polymerase activity. 2. 7-methylguanosine cap is added to the 5' end of the DNA after replication in eukaryotes. 3. snRNA is produced in transcription. 4. Initiator tRNA enter ribosome with the help of EF-Tu. 5. At low oxygen partial pressure Po2, myoglobin has lower oxygen affinity than hemoglobin.
- I. RNA polymerase binds to the promoter and the DNA unwinds. II. RNA polymerase moves along the DNA template and will synthesize mRNA. III. General transcription factors arrive and recruit RNA polymerase to the promoter. IV. The newly synthesized mRNA is processed and exported from the nucleus. Which of the following sequences shows the correct order for overall events of transcription? A. I, II, III, IV B. I, III, II, IV C. III, II, I, IV D. III, I, II, IVPlease consider the figure below. a. Give the name of the process illustrated in the figure. b. If this is part of the elongation stage, explain what is going to happen next. Use the labels, A, B, C and/or D to answer the question. C. What terminus of the protein is represented by the amino acid represented by label D?. Locate the -10 region hexanucleotide sequence in the following coding strand of DNA. Indicate the region of the RNA polymerase initiation site. AATTGGGATCCCTATAATGCGCCTACGTTGAGACGAGTGGACGC
- Which of the following statements below is incorrect? * A. the genetic code is overlapping B. the genetic code is universal C. degenerate codon specify the same amino acids D. the genetic code is triplet Which protein can break covalent bond? * A. Helicase B. Primase C. SSB D. DNA gyrase What is the complementary hnRNA base sequence produced from the DNA base sequence 5' C-T-A-T-A-C 3'? * A. 3' C-A-T-A-T-C 5' B. 3' G-A-T-A-T-G 5' C. 3' G-A-U-A- U-G 5' D. 3' C-U-A-U-A-G 5' Which of the following statements concerning the " cloverleaf" shape of tRNA molecules is correct? * A. four hairpin loops are present B. three hairpin loops and one open end are present C. two hairpin loops and two open ends are present…Consider the following DNA sequence: CATGTGTAGTCTAAA. Address the followin questions: AWrite the sequence of the DNA strand that would be replicated from this one. GTACACATCAGATT 2. White the sequence of the messenger RNA (MRNA) molecule that would be transcribed from the DNA strand. 30 GUACACAUCAGAU00 37 38 39 3. State how many codons the sequence specifies. 40 41 42 43 44 4. State how many amino acids the sequence specifies. 45B. One strand of a section of DNA isolated from E. coli reads: (Assume no start codon is required as is true under certain test tube conditions). 5' GTAGCCTACCCATAGG 3' What is the complementary DNA strand? 2. Suppose mRNA is transcribed from this DNA using the complementary strand as a template. What will be the sequence of the mRNA? 3. What would be the corresponding anticodons? 4. What peptide would be made if translation started exactly at the 5' end of this mRNA?