67 RNA interference was first discovered in Drosophila melanogaster. Yes or no 68 Which of the following is required for the bacterial ribosome complex to disassemble? A. EF1A-GTP b. Signal sequence c. Release factor D. EF1B 69 A transcription unit must have an initiation signal called a _____________ for accurate and efficient transcription to take place.

67 RNA interference was first discovered in Drosophila melanogaster. Yes or no 68 Which of the following is required for the bacterial ribosome complex to disassemble? A. EF1A-GTP b. Signal sequence c. Release factor D. EF1B 69 A transcription unit must have an initiation signal called a _____________ for accurate and efficient transcription to take place.

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 4CT

See similar textbooks

Similar questions

Below is a DNA sequence of the coding strand for a small gene. This gene has no introns. +1 5'- TATAAGATGCGTAGGATGCAGCTGTTTCAGCAGCCACGGTCTCGGCCCAGATAGCAGATAATAAACACGC GTA-3 a. Is this gene for an eukaryote or a prokaryote? Give one reason (. b. How many amino acids are expected to be coded by this gene? c. There are five underlined nucleotide sequences, interpret the purpose of three of them ONLY?
Below is the double stranded DNA sequence of part of a hypothetical yeast genome encoding a very small gene. Transcription starts at nucleotide immediately following the promoter. The termination sequence is TATCTC. How many amino acids will this protein have? 5' TCATGAGATA GCCATGCACTA AGGCATCTGA GTTTATATCT CA 3' 3' AGTACTCTAT CGGTACGTGAT TCCGTAGACT CAAATATAGA GT 5'
The coding sequences of Gene F and Gene G are shown by the double-stranded DNA below: Gene F 5' ATGGGAGCACCAGGACAAGATGGATATCATTAG 3' 3' AGTTACCCTC GT GG TCCTGTTCTACCTATAGTAS Gene G Questions: 1. Write down the messenger RNA sequence when Gene F is transcribed. 2. Write down the polypeptide chain when Gene F is completely expressed. 3. Write down the messenger RNA sequence when Gene G is transcribed. 4. Write down the polypeptide chain when Gene G is completely expressed.
28Elongation factor __________ reactivates arrested RNA polymerase II. A.TFIIEb.TFIISc.TFIIFD.TFIID 29Eukaryotic translation initiation proceeds through a ( ) mechanism. 30A variety of transcription ______________ factors helps to suppress transient pausing during elongation. A.terminationb.elongationc.none of the aboveD.initiation
Label each true or false A.STTGATA3 is the consensus sequence of the -35 regulatory region of prokaryotic genes B. The chromosomes in the image to the right illustrate a reciprocal translocation: (picture) C. When histones are deacetylated, nucleosomes transcription is repressed.
The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ a. Mark the point at which transcription will terminate. b. Is this terminator rho independent or rho dependent? c. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form.
Help me figure out how I should interpret and read these graphs. We are looking to see whether the m6a acceptor mutant will have an impact on splicing. Just need a detail breakdown thanks. I am presenting at journal club and need help interpreting will the goals in mind. We are currently conducting experiments to understand how the splicing of circE7 relates to the splicing of linear E6*I. Goal is to determine whether the mutation impact splicing. Trying to understand whether m6A will impact splicing. Sm should impact splicing ratio. My PI stated that the results show that it inhibited linear splicing and promoted backsplicing. I need a detailed explanation for the entirety so I can understand
The diagram below shows an imaginary eukaryotic structural gene containing two exons. The exon nucleotides are numbered beginning at the transcription start site and a portion of the intron is not shown to save space: Help Center? transcription start site promoter U STACAGTATAAATGAATTAATTGACGTATGTCAATCGGTAAGT...TCAGGTACT U UUU} Phe UUG} Leu exon 1 3 ATGTCATATTTACTTAATTAACTGCATACAGTTAGCCATTCA...AGTCCATGAATGACTTATGTGCGGTTATTTACTGAT... Second letter C Predict the amino acid sequence of the polypeptide encoded by this structural gene. The genetic code is provided below.
Give one example of a prokaryotic system of gene expression that is more complicated (duringtranscription at the promoter) than its corresponding eukaryotic system of gene expression.A. prokaryotes require general transcription factors to initiate transcriptionB. prokaryotes typically have activator and repressor DNA sequences thousands of nucleotides awayC. prokaryotes have three classes of RNA polymerasesD. prokaryotes always have their DNA tightly packed into higher-level structures than nucleosomesE. prokaryotes usually have polycistronic mRNA
73Dicer catalyzes Sequence-dependent single-stranded RNA cleavage. Yesorno 74Amino acid-coding regions within eukaryotic genes may be interrupted by ___________ regions. A.noncodingb.long terminal repeatc.split geneD.enhancer 75Which of the following cleaves the N-terminal methionine from polypeptides?A.Methionine isomeraseb.Methionine aminopeptidasec.Methionine carboxylaseD.Methionine transferase
e B 1_30*_SP23 - General Biology I (for majors)/11364 of € 2 A us page X F1 What conditions would we find on the gene of a prokaryote if there is low amounts of tryptophan within the cytoplasm? Select one: a. lactose would attach to the repressor removing it from the promoter promoting the transcription of lactase b. no repressor is on the promoter creating constant transcription of lactase c. tryptophan would attach to the repressor removing it from the promoter promoting the transcription of lactase O d. repressors would bind to the promoter stopping the transcription of lactase e. lactose would attach to the repressor removing it from the promoter promoting the transcription of tryptophan producing enzymes no repressor is on the promoter creating constant transcription of tryptophan producing enzymes tryptophan would attach to the repressor binding it to the promoter and stopping the transcription of tryptophan producing enzymes O f. O g. 2 Oh. tryptophan would attach to the…
The following is a DNA sequence of gene Z. The underlined sequence represents the promoter for gene Z and the underlined and italicized sequence encodes the gene Z ribosome binding (RBS) site. Transcription begins at and includes the T/A base pair at position 60 (bold). a. What are the nucleotides of the mRNA from gene Z?b. What are the amino acids encoded by gene Z? (A codon chart is found on the final page)