5. You are given three different substances that are known mutagens. Using a variety of techniques, you analyze the results of exposure to these substances. Your findings are shown in the table below. Using this data, match each of the three substances with one of the following molecular properties and explain your choice Molecular Properties I. One mutagen that looks like cytosine but forms a covalent bond with guanine II. One mutagen that can bind with either adenine or guanine III. A molecule that can insert itself between two base pairs in a DNA strand Substance Result of exposure A B C Increases the number of mutants that produce mRNA with AGA codons instead of AAA codons Significantly fewer viable colonies Increase in mutants containing frameshift mutations Substance Molecular Reason for choice property A B 8
Q: What is the primary reason for why pulse pressure increases with aging? a. Decrease in the number…
A: The objective of the question is to identify the primary reason for the increase in pulse pressure…
Q: Rose plants are octoploid (octo = 8). Gametes from a rose plant contain 40 chromosomes. Indicate…
A: The correct statements are:The number of chromatids in a rose plant cell at G2 of the cell cycle is…
Q: What do scurvy, brittle bone disease, and the hyperextensibility syndrome have in common?
A: Scurvy, brittle bone malady (osteogenesis imperfecta), and hyperextensibility syndrome (regularly…
Q: for the Spinothalamic Tract, can you show me a diagram for the pathway from the peripheral…
A: The spinothalamic tract is a sensory highway carrying pain, temperature, and crude touch sensations…
Q: Mammal-like reptiles like Gorgonopsid had specialized teeth, different from the uniform peg-shaped…
A: The question is asking whether the mammal-like reptiles, such as Gorgonopsid, had specialized teeth…
Q: What tests are useful in the classification of the cause of red cell hemolysis? Question 3…
A: The objective of the question is to identify the tests that are useful in determining the cause of…
Q: Which plant-based milk alternative has the highest level of saturated fats? Does it havemore…
A: Coconut Milk UnsweetenedExplanation:Introduction:In the realm of plant-based milk alternatives,…
Q: Exercise 2: Natural Selection 4. The different types of beaks on Darwin's finches can be thought of…
A: Each seed within a type (e.g., sunflower seed) will have slight variations in color, shape, or even…
Q: C. Illustrate the cell at meiotic metaphase I D. Illustrate the cell at meiotic anaphase II
A: Meiosis is a reductional devision of cell i.e. the number of chromosomes decrease at the end of this…
Q: In the complete absence of light, a rod will become strongly depolarized and increase its release…
A: Both cones and rods are where light is converted into a signal for the brain. Photopigments, or…
Q: 3'- AATAAAAAAGGTCCCAAAAAATTAGGGGAGACGGTACATAAA GAGTAGAGTCATAAATTTTAGAGATGCGTA - 5'
A: Following the hints and considering the complementary strand is required:Complementary DNA strand:…
Q: * This is a made up animal. Could dispersion be a population characteristic for the following…
A: Population dispersion is a vital ecological concept that refers to the way individuals within a…
Q: A set of beliefs and practives that involves the controlled selective breeding of human populations…
A: The question is asking to identify the term that describes a set of beliefs and practices aimed at…
Q: Classify the given items with the appropriate group. Neuron is hyperpolarized Occurs when…
A: Relative Refractory PeriodNeuron is hyperpolarized: This occurs during the Relative Refractory…
Q: A scientist wants to amplify a short region of the DNA molecule shown below inside the box. Pick the…
A: The Primer sequence should be matched the sequence on the bottom strand before the region of…
Q: QUESTION 1 In cucumbers, warty fruit (W) is dominant to smooth fruit (w) and dull fruit (D) is…
A: In the field of genetics, understanding how traits are inherited is often studied through crosses…
Q: what provides an image that is three-dimentional representation with little magnification (two…
A: The question is asking for a tool or device that can provide a three-dimensional image with little…
Q: Research questions I could ask for a grant proposal on coral reefs and ocean acidification
A: Coral reefs, portrayed as the rainforests of the ocean, are rich in biodiversity and play a basic…
Q: Caffeine inhibits feeding activity in tobacco hornworm larvae by inhibiting phosphodiesterase (PDE)…
A: The objective of the question is to understand how caffeine affects the feeding activity of tobacco…
Q: 3. The following diagram shows some of the metabolic processes taking place in a plant cell. a)…
A: Any biological reaction that takes place in a living cell and is completely regulated by enzymes is…
Q: How many siblings are in the second generation? O 10 3
A: A pedigree is a representation of the inheritance of a trait or character or disease from one…
Q: A 48 year-old woman with diabetic nephropathy was suffering from end-stage renal disease. They…
A: The objective of the question is to understand the potential side effects of prednisolone, a…
Q: Describe three characteristics of ambphibians. Think about reproductive needs, psyhical adaptations,…
A: The first characteristic of amphibians to consider is their reproductive needs. Unlike reptiles,…
Q: Which month of the Roman year was originally designated as Sextilis, the second month of summer,…
A: The question is asking for the Roman month that was originally called Sextilis, which was the second…
Q: Question questions. : Answer the following A) Compare between the two major types of cells. Also,…
A: The study of biology includes the complicated structure and work of cells, as well as the intuitive…
Q: Why are fruit flies good subjects with which to observe the process of evolution through natural…
A: The objective of the question is to understand why fruit flies are often used in studies of…
Q: Explain the process of digestion in medical terms from the mouth to the anus. Include where each…
A: The process of digestion is a complex series of events that occur from the moment food enters the…
Q: Two cultures of a facultative anaerobe are grown in the same medium, but one culture is exposed to…
A: Facultative anaerobes can live with or without oxygen. They prefer to live in aerobic condition, but…
Q: Q6.10. Which of the following is the best explanation for why extinctions are more likely with…
A: Isle Royale Simulation: Why Longer Growing Seasons Increase Extinction RiskThe most likely…
Q: 3. Sickle cell disease is an autosomal recessive genetic disorder that affects the shape of red…
A: a. To determine if the population is in Hardy-Weinberg Equilibrium (HWE), we need to compare the…
Q: https://journals.lww.com/acsm-essr/Pages/issuelist.aspx you will need to access the website and look…
A: I am also providing you a list apart from answers for the article I picked, you can refer to that,…
Q: Which molecule conveys protons from the chloroplast stroma into the thylakoid lumen? a. cytochrome…
A: The question is asking about the molecule that is responsible for transporting protons (H+ ions)…
Q: Mechanism of probiotics to enhance coral reef resilience.
A: The discussion of how probiotics might improve coral reef strength is established within the concept…
Q: Select the statements below that are TRUE. Select 4 correct answer(s) Question 14 options:…
A: The objective of the question is to identify the correct statements related to various biological…
Q: What do cells need to take in from the bloodstream to get usable energy?
A: The question is asking about the substances that cells need to absorb from the bloodstream in order…
Q: draw a 2n=6 cell as it goes through mitosis and meiosis
A: 2n = 6 cell as it goes through mitosis and meiosisExplanation:This is how your drawing should look…
Q: What is the validity of concern for potential marine extinction? Defend these concerns or lack…
A: Concern for potential marine extinction is undeniably valid given the multitude of threats…
Q: 99.9% of our DNA is the same across all humans worldwide. True or false?
A: The objective of the question is to verify the statement that 99.9% of our DNA is the same across…
Q: At prophase of meiosis 2, how many chromosomes will be in a cell from the same organism as this…
A: Meiosis is a cell division in which a diploid cell divides to form four haploid daughter cells. It…
Q: Which diagnostic result in the patient taking furosemide requires rapid action taken by nurse Blood…
A: Furosemide is a diuretic medication commonly used to treat conditions such as hypertension and…
Q: Chemical bond energy: Is the energy used by photosynthesis for the fixation of carbon Is generated…
A: The question is asking us to identify the correct statement(s) about chemical bond energy. Chemical…
Q: Which statement below is consistent with making a Type I error?
A: In the context of hypothesis testing in statistics, a Type I error occurs when the null hypothesis…
Q: What is the sister group to Innovatiocaris maotianshanensis? The phylogeny shows that some named…
A: A clade is defined as a group that contains all the descendents of a common ansector thus forming a…
Q: The direct formation of ATP by the transfer of a phosphate group from a donor molecule to ADP is…
A: The question is asking to identify the process by which ATP (adenosine triphosphate) is directly…
Q: Based on your understanding of dose response curves, if curve A represents the desired effect of a…
A: Of course, work in the field implies the use of a dose-response curve, which is a graphical…
Q: Q1
A: The question is asking about the possible sources of contamination in a product. Contamination…
Q: Chronic obstructive pulmonary disease Discribe in details: Epidemiology Etiology Types/…
A: The objective of the question is to provide a detailed description of Chronic Obstructive Pulmonary…
Q: If a population of white throated sparrows was found in a much warmer climate, where homozygous…
A: Supergenes play a critical part within the hereditary makeup and evolutionary adaptability of life…
Q: A man was prescribed barbiturates 6 months ago. However, with time the physician had to increase the…
A: Barbiturates are a class of drugs that act as central nervous system (CNS) depressants which were…
Q: Which Roman deity was the wife of the first “sky-father”, and the mother of twelve Titan gods and…
A: The question is asking us to identify the Roman deity who was the wife of the first 'sky-father' and…
Unlock instant AI solutions
Tap the button
to generate a solution
Click the button to generate
a solution
- A 4. You are given three different substances that are known mutagens. Using a variety of techniques, you analyze the results of exposure to these substances. Your findings are shown in the table below. Using this data, link each of the three substances with one of the following molecular properties and explain your choice. B C I. Substance II. III. One mutagen that looks like cytosine but forms a covalent bond with guanine One mutagen that can bind with either adenine or guanine A molecule that can insert itself between two base pairs in a DNA strand Result of exposure Increases the number of mutants that produce mRNA with AGA codons instead of AAA codons Significantly fewer viable colonies Increase in mutants containing frameshift mutations6. Mutation analysis of GCK gene in patients with diabetes revealed a c.114 TàA (shown in bold and underlined) substitution in heterozygote state. In order to check the mutation in healthy individuals, restriction enzyme analysis will be used. a) (5p) Which enzyme can we use to differentiate wild type and mutant sequence? Please indicate which allele (wild type or mutant allele) will be cut with the restriction enzyme. Use table 1 shown below. b) (10p) Draw the expected agarose gel result of a homozygous wild type, homozygous mutant and heterozygote individual after restriction enzyme analysis. ATGAGGCTCTTTGCCACCAGTCCCAGTTTTATGC ATGGCAGCTCTAATGACAGGATGGTCACCCCTG CTGAGGCCACTCCTGGTCACCATGACAACCACA GGCCCTCTCAGTATCACAGTAAGCCCTGGCAGG AGAATCCCCCACTCCACACCTGGCTGGAGCACG AAATGCCGAGCGGCGCCTGAGCCCCAGGGAAGC AGGCTAGGATGTGA Figure 1. GCK gene sequence. Length of the fragment is 213bp. Table1. The restriction enzymes and their recognition sequences. Restriction enzyme|Recognition sequence GG/CGCC Nar…I. The DNA template, 3'–CGTTACCCGAGCOCGTACGATTAGG–5', was exposed to a mutagen, resulting in the following three templates. 2. A. 3'–CGTTACCCGAGCCGTAACGATTAGG-5' nserti on leuding to frame shift B. 3-CGTTACCCGATCCGTACGATTAGG–5' Point - Transversin C. 3'-CGTTACCCGAGCCGTTCGATTAGG–5' Transition I. Transcribe and translate each template and write down the primary sequence of the resulting polypeptide/protein. Describe how each of the mutations will affect the final protein product from the corresponding template. N met -gla - Ser- Ala -cys -Stup-d Predict whether gene expression (from initiation of transcription to final protein product) would be faster in a prokaryotic or eukaryotic cell. Explain your answer.
- 5. The nucleotide sequences of the DNA molecules in the figure below were obtained from four different individuals, one wild type and three mutants. Wild Type 5'-TTATCCATGATCGGATCGATCCATTAGCCGA-3' 3'-AATAGGTACTAGCCTAGCTAGGTAATCGGCT-5’ Mutant I 5'-ATCCATGATCGGATTGATCCATTAGCCGAAT-3’ 3'-TAGGTACTAGCCTAACTAGGTAATCGGCTTA-5’ Mutant II 5'-CCGTTATCCATGATCGGATAGATCCATTAGCC-3’ 3'-GGCAATAGGTACTAGCCTATCTAGGTAATCGG-5’ Mutant III 5'-CACCGTTATCCATGATCGGAACGATCCATTAGC-3’ 3'-CAGGCAATAGGTACTAGCCTTGCTAGGTAATCG-5’ a) Identify the open reading frames in each sequence of DNA and translate them into proteins. Write down the sequence of amino acids that will be obtained after translation: b) Which of the mutations above would be least likely to cause a change in the function of the protein? Why? c) Which of the mutations above would probably cause a major disruption in the function of the protein? Why?1. You are working with a known chemical that can cause a mutation in the DNA. You decide to use the Replica Plating experiment to confirm that this is the case. Please talk about how this experiment works. Also, please discuss any two types of mutations that could take place due to this mutation and what these mutations can cause when DNA is made into protein. 2. What is a difference between prokaryotic and eukaryotic gene expression? Please explain. Also, discuss briefly the significance in splicing, why this is done and how this leads into variety of different polypeptides.9. The restriction site sequence for the restriction enzyme Sau3Al and BamHI include four identical bases, making their sticky ends identical as shown in the figure. Let's say you have foreign DNA whose flanking regions were cut with Sau3AI. Also, you want to use a plasmid containing a BamHI restriction site. (1) Would it be possible to ligate the foreign DNA into the BamHI site of the plasmid? Explain. lison Lenharc (2) Would it be possible to cut the ligated sites with Sau3AI? What about BamHI? What problems will you expect if you use BamHI? BamHI Sau3Al G-G-A-T-C-C பர்டிய C-C-T-A-G-G G-A-T-C Hi- 目1目 C-T-A-G C-C-T-A-G C-T-A-G G-A-T-C-C E E G-A-T-C= 10. An ampicillin-resistant, tetracycline-resistant plasmid, pBR322, is cut with Pstl, which cleaves within the ampi resistance gene. The cut plasmid is ligated with Pstl digested Drosophila DNA to prepare a genomic library, and t rcoli K12
- Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…3. Primer Design You are analyzing the region of DNA shown below to determine how many AATG repeats are present. To do so, you must amplify the entire region of AATG repeats. Design primers of 16 bases each so they anneal outside the region of interest. More than one primer pair is possible, but just give one. 51-АСTСGCАCGAACAGGCACTTAGGAATGAATGAАTGAATGAATGAАTGAATGACCTGтстссттсССАСТтсстСС-3' 3'-TGACCСтGтсттстссстGААТССТТАСТТАсТТАСТТАСТТАСТТАСТТАСТGGACACACCAAGGстСAAGGAGG-5' a. Primer 1: Primer 2:7a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of mutation occurred: AAGCCGTTAC 7b. Where did the mutation take place?
- 2. Dr. Kim at Research Center performed shotgun Sanger sequencing on an unknown DNA sample, and obtained the following reads (12 reads). Since the length of each read is quite short, Dr. Kim ran the original sample in a gel electrophoresis, and realized that the original DNA is just 50 base pairs long. (Please note that the resolution of gel electrophoresis is not so good. Thus, we cannot figure out the exact length of DNA using gel electrophoresis in the real world.) 2) AGCCG AGATG GCTG 4) CTGCA AGCCG A 1) САСТС ССAGT GTACC T 3) GGAGT CAATC GC 5) GGCTG TGCTT GG 7) GATGG CTGTG 9) CAGTG TACCT GCA 11) TGCAA GCCGA G 6) CTTGG AGTCA ATCGC 8) САСТС ССAG 10) GCTGT GСТTG G 12) TGCTT GGAGT (a) Find the sequence of the original DNA (reconstruction), and align each read with the reconstructed DNA sequence. (hint: put all reads on a ppt slide, and move them around to find overlaps.) (b) Calculate coverage at each nucleotide position of the reconstructed DNA, i.e., how many reads cover that…2. Dr. Kim at Ewha Research Center performed shotgun Sanger sequencing on an unknown DNA sample, and obtained the following reads (12 reads). Since the length of each read is quite short, Dr. Kim ran the original sample in a gel electrophoresis, and realized that the original DNA is just 50 base pairs long. (Please note that the resolution of gel electrophoresis is not so good. Thus, we cannot figure out the exact length of DNA using gel electrophoresis in the real world.) 1) САСТС ССAGT GTACC T 3) GGAGT CAАТC GC 5) GGCTG TGCTT GG 7) GATGG CTGTG 9) CAGTG TACCT GCA 11) TGCAA GCGA G 2) AGCCG AGATG GCTG 4) CTGCA AGCCG A 6) CTTGG AGTCA ATCGC 8) САСТС ССAG 10) GCTGT GCTTG G 12) TGCTT GGAGT (a} Find the sequence of the original DNA (reconstruction), and align each read with the reconstructed DNA sequence. (hint: put all reads on a ppt slide, and move them around to find overlaps.) (b) Calculate coverage at each nucleotide position of the reconstructed DNA, i.e., how many reads cover that…1. The gel presented here shows the pattern of bands of fragments produced with several restriction enzymes. A N E Wells 8. 1 0.5 A = Aatl N= Ncol E= EcoRI (a) From your analysis of the pattern of bands on the gel, draw the correct restriction map and explain your reasoning. (b) The highlighted bands (magenta) in the gel hybridized with a probe for the gene pep during a Southern blot. Where in the gel is the pep gene located? Mark the area on the restriction map. < +Z 3. 2. Fragment size (kb)