5. If dividing cells are grown in a culture medium containing radioactive thymidine, the thymidine will be covalently incorporated into the cell's DNA during replication. The radioactive DNA can be detected in the nuclei of individual cells by autoradiography (i.e.. by placing a photographic film over the cells, radioactive cells will activate the film and show up as black dots when looked at under a microscope). During whatphase of the cell cycle will the radioactive thymidine be incorporated? Why?

5. If dividing cells are grown in a culture medium containing radioactive thymidine, the thymidine will be covalently incorporated into the cell's DNA during replication. The radioactive DNA can be detected in the nuclei of individual cells by autoradiography (i.e.. by placing a photographic film over the cells, radioactive cells will activate the film and show up as black dots when looked at under a microscope). During whatphase of the cell cycle will the radioactive thymidine be incorporated? Why?

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter10: Cell Division And Mitosis

Section10.4: Cell Cycle Regulation

Problem 1SB

See similar textbooks

Similar questions

6. Consider an experiment in which cells are radioactively labeled by this method for only a short period of time (about 30 minutes). The radioactive thymidine medium is then replaced with medium containing unlabeled thymidine, and the cells are grown for some additional time. At different time points after replacement of the medium, cells are examined in a microscope. The fraction of cells in mitosis (which can be easily recognized because their chromosomes are condensed) that have radioactive DNA in their nuclei is then determined and plotted as a function of time after the labeling with radioactive thymidine. labeled mitotic cells (%) 100 75- 50 25 0 bod 0 5 10 15 20 25 30 time (hours) a) Would cells at all phases of the cell cycle contain radioactive DNA immediately after the labeling procedure? Why? b) Why are there initially no mitotic cells that contain radioactive DNA? c) Explain the rise and fall and then rise again of the curve. d) Estimate the length of G2 for these cells e)…
4) Describe in detail how p53 and MDM2 regulate cell division in a normal, healthy cell. You should describe 1) how these proteins cooperate to allow a cell to go through the cell cycle, 2) how they cooperate to stop the cell cycle, and 3) how they allow the cell cycle to continue again after having stopped it initially. You may use point form if you want.
6) What phase of the cell cycle would be altered, and what would change if you treated a cancer cell with a drug that a) interfered with DNA replication. b) stopped the spindle fibers from elongating.
1. It is S phase of the cell cycle, and time to replicate the cell’s DNA. Using the following strand of DNA as a template, create the complementary strand:GCTCCTTACGGGCCCAATGACCTGAATGTACGAGATCCCATCCTT
1.In a cell culture you are tracking cell division and DNA replication. You start with 100 cells, and let the cells divide two rounds with fluorescent nucleotides present in the media, instead of normal nucleotides. This allows for the visualization of the DNA under a fluorescence microscope. After two rounds of division, you remove the fluorescent nucleotides, and let the cells divide one more round. How many NON-fluorescently labeled cells do you expect to find? Select one: a.800 b.100 c.400 d.0 e.200 2. Which of the following are protein - RNA complexes? a.Polymerase b.Ribosome c.aminoacyl trna synthetase d.Spliceosome
7. Complete the following for a cell that contains 6 chromosomes in early interphase (before replication occurs) Remember in early interphase each chromosomes exists as a simple chromatin strand, which replicates (doubles) just before prophase.
2.) One experimental tool used in the biological research and in clinical settings is called Fluorescent Activated Cell Sorting (FACS) or cell cytometry. For example, a cell membrane permeable (or nonpolar) chemical called Hoescht 33342 dye will specifically label DNA. Interpret the graph (Figure 17-4) that illustrates normal cells that have been labeled with Hoescht 33342 dye, and assign which phase(s) of the cell cycle (G1, S, G2, or M) corresponds to the fluorescence intensity. Justify your answers. 1 relative fluorescence per cell Figure 17-4 Analysis of Hoechst 33342 fluorescence in a population of cells sorted in a flow cytometer (Problem 17-15). number of cells
3) Examine the graph showing the relative percentage normal and cancer cells spend in various stages of the cell cycle. Based on the information in the graphs, infer how cancer cells differ from typical, noncancerous cells. Select ALL that apply. A) Cancer cells do not replicate their DNA. B) Cancer cells replicate their DNA too quickly. C) Cancer cells do not go through interphase during their cell cycle. D) Cancer cells spend more time dividing compared to typical cells. E) Cancer cells do not always grow to the same size as typical cells. more than 1 answer. not graded
1 3 4 Here is a replication fork during S phase of the cell cycle. DNA strands are labeled 1-4. After mitosis and cytokinesis is complete, One daughter cell will have strands 18&2, another will have strands 3&4 One cell will have 1&3, the other will have 2&4 Each of the strands (1-4) will be in a different cell. All four strands will end up in the same cell, and the other cell will have the complementary strands. Both A and B are equally likely.
3) Draw a diagram of the cell cycle (G1, S..) and indicate places where errors in cell division might lead to cancer.
Assume that you are growing mammalian cells in culture. You are able to synchronize the culture, meaning all of the cells undergo each stage of the cell cycle at the same time. The graph shows the amount of DNA in the nuclei of cells during cycle 1 and cycle 2 of cell growth II III IV First cycle Second cycle At which stage(s) would you NOT find condensed chromosomes? Select all that apply Amount of DNA in nucleus
4. Figure below shows drawings of a cell at various stages in the mitotic cell cycle. A B E (a) List the letters shown in figure above in the order in which these stages occur during a mitotic cell cycle. [2] (b) Explain what is happening in stage D in figure above. [2]