Q: Acyclovir is best said to be a / an: Select one: O a. nucleoside Ob. nuclear base C. MRNA drug Od…
A: Acyclovir : Acyclovir is an antiviral medicine generally used for the treatment of viral diseases.…
Q: Please discuss the value of international normalized ratio (INR) as a test. Why do you think this is…
A: PT test is the normal blood test conducted to record the time taken for blood to clot.
Q: 4. What is the DFV of a 40x objective lens if the DFV of a 10x objective lens is 3 mm? Express your…
A: Microscopes are extremely significant equipment that is mostly utilized in the field of science. The…
Q: How are antibodies to Salmonella H antigen produced? A) antibodies to H antigen are isolated from…
A: Salmonella is a bacteria. It has H antigen on the flagella. It is a slender thread like portion on…
Q: I. CASE ANALYSIS. Read carefully the scenario below and answer the questions that follow. AAG Lys A…
A: Forensic analysis using DNA samples The DNA sequences can be a helpful tool to determine the…
Q: Answer the following questions in paragraph form consist of at least five sentences. 1. Explain…
A: The human body consists of billions of smaller components divided into four categories: cells,…
Q: Many amino acid biosynthetic operon under attenuation control are also under negative control.…
A: In bacteria, transcriptional attenuation is a common means of regulating gene expression in response…
Q: 24. The most destructive practice of harvesting wood products, which cuts down all of the trees in a…
A: Clear-cutting is a silvicultural system that removes an entire stand of trees from an area of 1 ha…
Q: - Coronary arteries route oxygen rich blood into the tissues of the heart. of the: d. descending…
A: Two major coronary arteries branch off from the aorta. They branch off from a point where aorta…
Q: Question - What is biology? A) The study of DNA. B) The study of the environment. C) The study of…
A: Question - What is biology? A) The study of DNA. B) The study of the environment. C) The study of…
Q: A pregnant woman is carrying a triplet inside her womb. They want to determine the number of boys or…
A: Here a is the probability of having a boy and b is the probability of having a girl. The…
Q: Air sae comection with - humerus bone Humenus bone Branchus 4 Heart 6 7 8. Tail
A: As we know that like humans , animals are also composed of different cell types . Group of cells…
Q: Lichens are formed by an association between: fungi and plants O algae and plants O protists and…
A: Introduction Ecology:- It is the study of the relationship between living organisms and their…
Q: Positive thigmotropism is a response in plants in which they move and grow toward an object the…
A: Thigmotropism can be defined as a response to touch;It is basically a curvature movement in which a…
Q: 3. You've discovered an exotic species of plant that can have three unusual autosomal recessive…
A: Linkage is defined as the inheritance of genes as a unit together in the offspring if they are…
Q: Match the following microorganisms with the descriptionthat best applies:Algae (a) Multicellular…
A: An organism that can be seen only through a microscope, not visible through naked eyes are called…
Q: The O-antigen is part of the bacterium's which is found in the outer membrane of some bacterial cell…
A: Introduction Antigen:- These are any substance that causes the body to make an immune response…
Q: In accordance to mitosis and meiosis, compare and contrast the processes in plants vs in animals.…
A:
Q: Von Gierkes disease is the deficiency of Glucose -6- phosphate O True O False is the precursor for…
A:
Q: Concentration of Oxygen in Water Temperature (°C) Oxygen Concentration in Freshwater (ppm) Oxygen…
A: Introduction: Fresh water contains more dissolved oxygen than the seawater and it is…
Q: Identify two ways in which the immune responses in gut mucosal tissues contrast with those initiated…
A: Mucosal tissues are found in the body as plasma cells, which are mostly found on epithelial…
Q: What is carotenoids, carotenes and xanthophyll? Why these compounds are important in human diets?
A: Introduction Photosynthesis is the process through which green plants and other organisms use light…
Q: Name the method that would be used for each of the following: listening to a patient for a heart…
A: Introduction Heart murmurs are sounds generated by turbulent blood in or near your heart, such as…
Q: The diagram below represents results of agarose gel electrophoresis performed after PCR…
A: Please follow step 2 for detailed explanation.
Q: DNA Sequence Enter DNA sequence below Original sequence ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG…
A: DNA contains the genetic information about the characteristics features of te organism present in…
Q: A survey was conducted for a certain trait (the ability to roll tongue or inability to roll the…
A: Introduction Hardy-Weinberg equilibrium:- It states that the genetic variation in a population will…
Q: The biggest obstacle in the acceptance and development ofthe science of microbiology was the(a) Lack…
A: Introduction Microbiology is the scientific study of unicellular, multicellular, and acellular…
Q: 3 ANE .MOO城が
A: The plasma membrane, also called the cell membrane, is the membrane found in all cells that…
Q: 4. In owl, barring (B) is sex-linked and dominant, the recessive allele (b) producing solid black…
A: In owl , there are two types of traits . I ) In case of first trait , Barring is dominant and is…
Q: Name the method based on a conception, that the diminishing of toxic substances quantity in the…
A: To identify: To identify the correct sorption of toxic substances quantity in the stomach and…
Q: All of the following are benefits of breast feeding EX a) The baby will receive complex…
A: In infants below 6 months of age, it's advised that breastfeeding is to be followed. Breastfeeding…
Q: Unlike cytotoxic T lymphocytes, NK cells do not _____. (Select all that apply.) a. secrete…
A: Natural killer (NK) cells are lymphocyte that descend from the very same progenitor as T and B…
Q: If a phage is undergoing lytic growth, which protein is bound to the operator region? O Both Lambda…
A: INTRODUCTION Lytic stage of phage This is the reproductive stage of bacteriophage it include 6…
Q: To explain: The way in which the plants with nodules for nitrogen-fixing bacteria might…
A: Answer--- Nitrogen fixing bacteria are organisms that are able to convert atmospheric nitrogen into…
Q: 2. The image above represents a simple cladogram for the primate order, where the letters are nodes…
A: Grasping hand and foot are observed in each primates, grasping foot is absent in humans most…
Q: Here is a family pedigree for an imprinting disorder caused by a loss of function mutation in a…
A:
Q: In the rumen, unsaturated fatty acids can be converted to saturated fatty acids. True False
A: Fatty acids are the part of lipids. The fatty acids are attached with the glycerol by the ester…
Q: Gestation takes about -____weeks. a) 38-42 b) 44-46 c) 28-30 O d) 48-52
A:
Q: Calcitonin is enzyme that functions to reduce blood calcium levels True O False CK may be derived…
A: Storage lipids, also known as triacylglycerols, membrane lipids, which include glycerophospholipids…
Q: Greetings! Provide an illustration and describe the different types of egg as to the distribution…
A: In specific animals that produce eggs, the yolk (otherwise called the vitellus) is the supplement…
Q: Kernel color in wheat is controlled by 2 pairs of genes (AABB). Determine the color of each…
A: The inheritance of kernel color in wheat is controlled by two genes. These are A and B genes.
Q: DNA DNA Leading strand mRNA tRNA Amino Acid A T G A A A G T C A T…
A: Deoxyribonucleic acid(DNA) is a molecule comprised of two polynucleotide chains coiled around each…
Q: 6. What is the DFV of a 25x objective lens if the DFV of a 100x objective lens is 1.5 mm? 7. Using…
A: A microscope is a laboratory instrument used to examine objects that are too small to be seen by the…
Q: Concentration of Oxygen in Water Temperature (°C) Oxygen Concentration in Freshwater (ppm) Oxygen…
A: The earth's surface is covered 71% by water. Life on earth depends on the availability of…
Q: 25. Modern agroecosystems differ from natural ecosystems in all of the following ways except: A.…
A: Answer
Q: To describe: The ecological niche of humans.
A: The intended function that an organism performs within an environment is its niche.The biotic…
Q: what is the sun made of?
A: To explain: To explain about the sun and its composition
Q: explain why it is important to maintain sterility when inserting a foley cathether
A: Foley's catheter is an indwelling catheter, i.e. it can be left in place for longer durations than…
Q: In a chemical reaction catalyzed by an enzyme, the enzyme: O becomes the substrate is destroyed does…
A: Enzymes Enzymes are biological catalysts that speed up the rate of the biochemical reaction. Most…
Q: Insulin is produced using O Aspergillus OGolden rice O Corn O Safflower
A: Insulin in human is used to lower the blood glucose levels in diabetic patients since they are not…
Answer number 5 only.
Step by step
Solved in 2 steps
- Direction: Answer the following questions in paragraph form consist of at least five sentences. 1. Explain the Body Systems and Homeostasis in your own words. 2. Define the Lungs: Bronchi and Alveoli and give its function.Rodjerick Assignment: 1. Discuss the steps and sequence on Artificial Respiration and Cardio Pulmonary Resuscitation 2. 2. Discuss soft tissue injuries/wounds 3. The different kinds of open wound 4. Discuss burns Submit tomorrow. write on oneCase Study 1 Topic: Musculoskeletal System Pathology (Axial Focus) A patient comes to your ER with difficulty breathing because of a large knife in their back. The knife is located lateral to the transverse process of T5 on the right side of the body. Fortunately, the knife does not penetrate the heart. You are to answer the following questions pertaining to this scenario. 1. What axial muscles could possibly be injured by knife 2. Why would this patient have difficulty breathing? In addition, list at least four muscles important for breathing and explain whether these muscles lift or depress the ribs.
- ALSO answer the questions below: 1. Describe all of the steps of the Chain of Survival. 2. Name the 8 action steps in one rescuer adult CPR. 3. Name the two main parts of CPR. 4. What is the most important part of CPR? 5. What are the 6 concepts in High-Quality CPR? 6. List the steps in giving breaths to an adult and a child... 7. What is the hand placement in one rescuer CPR to an infant? 8. What is the age limit for infants? Children? Adults? 9. What is the depth for chest compressions on an adult? 10. What is the difference between sudden cardiac arrest and a heart attack?make sure you do not use the internet. Be specific with your answers, this means that I am expecting you to add in some structures and functions involved. Each question should be approximately 4 sentences long. 1. Describe how the circulatory system and the respiratory systems work together.Give typed full explanation Discussion # 25c. Pulse, Respiration and Pain 33 unread replies.33 replies. You are walking by a resident’s room. You hear your coworker tell the person, “You can’t be in pain. You just had a pain pill 20 minutes ago.” Is your coworker’s response correct? Explain. What should you do?
- 1. How is a child's age defined for CPR? 2. When there are two rescuers, what is the ratio of compressions to breaths for children and infants? 3. Name 4 instances when it is acceptable to stop CPR. 4. When doing single rescuer CPR for an infant, describe your hand placement and what part of the hand you would use. 5. For two rescuer infant CPR describe how compressions would be done. 6. What age and weight are Child AED pads appropriate for? 7. If you have a two year old child and only adult AED pads are available ( the pads will touch on the chest); how would you place the pads? 8. An adult is choking, describe your hand placement to clear the airway 9. Name two alternative methods to clear the airway of a choking adult or child 10. What is the technique used to clear the airway in a conscious choking infant? Please do not plarized no hand written thank youTOPIC: Respiratory System (Pneumotorax/Heart Disease) Give the mechanics of breathing/internal-external respiration for a patient with pneumothorax. Also, what is the body's way of correcting pneumothorax?Chapter 3 Cardiorespiratory Endurance: Assessment and Prescription The following are the videos you will need to watch for Chapter 3. Take notes, create one paragraph per Video 1. Energy System, ATPin the body https://youtube.com/watch?v=dWe8vtztW-4&feature=shares 2. The Heart and Circulatory System https://youtube.com/watch?v=CWFvxn0qDEU&feature=shares 3. ATP, Adenosine Triphosphate, Energy https://voutu.be/NN5Y57NbrU 4. Human Circulatory System https://youtube.com/watch?v= qmNCJxpsr0&feature=shares
- Chapter 3 Cardiorespiratory Endurance: Assessment and Prescription The following are the videos you will need to watch for Chapter 3. Take notes, create one paragraph per Video 1. Energy System, ATPin the body https://youtube.com/watch?v=dWe8vtztW-4&feature=shares 2. The Heart and Circulatory System https://youtube.com/watch?v=CWFvxn0qDEU&feature=shares 3. ATP, Adenosine Triphosphate, Energy https://voutu.be/NN5Y57NbrU 4. Human Circulatory System https://youtube.com/watch?v= qmNCJxpsr0&feature=shares answer it with completely one paragraph each videoA nurse is explaining the rationale for performing leg exer-cises after surgery. Which reason would the nurse include in the explanation?a. Promote respiratory functionb. Maintain functional abilitiesc. Provide diversional activitiesd. Increase venous returnVital Signs and Examination Basics 1.How is the chief complaint recorded in the medical history of a patient? 2.Name five (5) anatomical places in where temperature can be measured. 3.Where is the apical pulse taken? 4.What is the normal heart rate value? 5.Name five (5) situations that can increase the heart rate. 6.What is the normal respiratory rate for adults? 7.What are two (2) indications to give to a patient before blood pressure is taken? 8.What is the equipment needed to take blood pressure? 9.Name the six (6) methods of examination. 10.What are three (3) functions of a medical assistant during a Pap smear test?