46 What is the A-site of the ribosome? A. exit site b. aminoacyl-tRNA binding site c. peptidyl-tRNA binding site D. peptidyltransferase site 47 This sequence motif, which is called the ( ) , is usually located 25 to 30 bp upstream from the transcription initiation site. 48 Pre-mRNA requires specific sequences for precise __________ to occur. A. splicing b. tagging c. replication D. skipping

46 What is the A-site of the ribosome? A. exit site b. aminoacyl-tRNA binding site c. peptidyl-tRNA binding site D. peptidyltransferase site 47 This sequence motif, which is called the ( ) , is usually located 25 to 30 bp upstream from the transcription initiation site. 48 Pre-mRNA requires specific sequences for precise __________ to occur. A. splicing b. tagging c. replication D. skipping

Name: 46What is the A-site of the ribosome?A.exit siteb.aminoacyl-tRNA bindi
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 46What is the A-site of the ribosome?A.exit siteb.aminoacyl-tRNA binding sitec.peptidyl-tRNA binding siteD.peptidyltransferase site47This sequence motif, which is called the ( ) , is usually located 25 to 30 bp upstream from the transcription initia

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....

See similar textbooks

Similar questions

From the mRNA base sequence CUU-AUG-GCU-UGG-CCC-UAA A.What anticodon sequences of tRNA’s are coded? B.What was the base sequence in the original DNA strand was made? Please answer completely will give rating surely Both questions answers needed
55__________________ assemble to form a spliceosome, the splicing machine that excises introns. A.snRNAb.tRNAc.Micro RNAD.rRNAs 56Eukaryotic initiator tRNA is charged with a formylated methionine. Yesorno 57Eukaryotic mRNA can be purified by separating molecules a mixture of total RNA by: A.Oligo (dG) cellulose chromatographyb.Oligo (dT) cellulose chromatographyc.Oligo (dC) cellulose chromatographyD.Oligo (dA) cellulose chromatography
Below is the DNA sequence of a patient with overlapping genes (a single mRNA has multiple initiation points for translation) for two different proteins (DADαs and AMA): 5’- GTCCCAACCATGCCCACCGATCTTCCGCCTGCTTCTGAAGATGCGGGCCCAGGGAAATCTCTAACG-3’ 1. Indicate the DNA sequence coding for RNA. 2. Indicate the amino acid sequence of each of them.
-Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG -If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTT
At least one nonsense suppressing tRNA is knownthat can suppress more than one type of nonsensecodon.a. What is the anticodon of such a suppressing tRNA?b. What stop codons would it suppress?c. Could this tRNA possibly also function as a missense suppressor?d. What are the amino acids most likely to be carriedby this suppressing tRNA?
Use the Genetic Code below to help you answer the following questions. The nucleotide sequence of a hypothetical eukaryotic gene is: 3'- CCC CAT CAG TCA AGG GAA - 5' a. Provide the mRNA of the non-mutated gene. b. Provide the linear amino acid sequence of the non-mutated gene. üü c. Examine the mutated DNA sequence below. What would be the sequence of the mRNA? ü Mutated DNA sequence: 3' CCC CAC AGT CAA GGG AA 5' d. Provide the linear amino acid sequence of the mutated gene and identify the type of mutation. e. Comment on the consequences of this type of mutation?
Given the following DNA sequence: ATCGGATCCGGTTAACTATTTAAAGCA a. predict the compliment strand of dna (coding strand) b. predict the transcribed product of the coding strand (mRNA transcript) c. given the genetic code table, predict the amino acid sequence of the transcript d. predict the amino acid sequence if the A underlined became deleted
The sequence below is a template strand sequence for a gene (a very short one!). Identify the start codon and the amino acid sequence of this gene. Write your answer in 3 letter amino acid code. Put a hyphen between each amino acid. You should also include a description of any working or steps you have taken to determine your answer. 5' AGTCAGCAAGAAGACATCAGTGTTCCCATCTGT 3' Paragraph V B I U A = 8⁰ + v 11.
First Letter A G U с 22. Using the provided "Genetic Code-Reference" answer the following question. Based on the following DNA template strand, write out the amino acid chain produced. 23. Consider the following mRNA base codon sequence 5'-AUC-GAA-3' and the provided "Genetic Code-Reference". Genetic Code-Reference UUU UUC UUA UUG CUU CUC CUA CUG (mutated or silent) (mutated or silent) b. Briefly explain your reasoning for each. (be sure to include both parts) AULLY AUU a. Label which of the following would result in a mutated amino acid sequence or a silent mutation. (May help to first determine the original amino acid sequence, then compare to mutations) U Phe mRNA codon sequence: anticodon sequence: amino acid sequence: Leu Leu 5'-AUA-GAA-3' Val 5'- AUC-GAC-3' AUC Ille AUA AUAJ *AUG Met/Start GUU GUC GUA GUG UCU UCC UCA UCG) CCU) CCC ccc CCA 000 CCG ACU ACU ACC ACA ACG, C GCU GCC GCA GCG Second Letter Ser Pro Thr 3'-CAA-GTC-TGT-5' Ala UAU UAC) Tyr Туг A **UAA Stop UAG Stop CAU] CACJ…
Give only typing answer with explanation and conclusion which of these choices represents one possible corresponding mRNA sequence that can be transcribed by RNA polymerase, and later translated by ribosomes from the following DNA template? 5'- CTGTATCCTAGCACCCAAATCGCAT - 3'; A. 5'- CTA GCA CCC AAA TCG CAT TAG - 3', B. 5' - AUG CGA UUU GGG UGC UAG - 3', C. 5' - AUG CGA UUU GGG UGC - 3', D. 5- ATG CGA TTT GGG TCG TAG - 3'
Please answer these questions, I provided a picture of the codon table. 1. Below is the template DNA sequence for an entire (short) gene that contains no introns. TRANSCRIBE this entire gene sequence: 3'- T C G A C T A C C A T G G T G T C A G A A T T T G T G G -5' 2. TRANSLATE the gene sequence, using the same rules that a ribosome would use on it. 3. Describe what you did in order to translate this sequence. (2-3 sentences) 4. IF the TGGTG sequence in the middle of this gene were an intron, then would this alter the translation that you just performed? Explain your answer. (2-4 sentences)
A mutant DNA strand was transcribed then translated to proteins. a. What is the protein product of the mutant DNA strand? The sequence of the mutant strand is shown below: 5'-TGCCATAACTGTTCGTACTGGCAAATTGCC-3' 3'-ACGGTATTGACAAGCATGACCGTTTAACGG-5' b. The mutation altered the sequence of the wild type template DNA such that a degenerate codon for a basic amino acid in the wild type was converted to a non-degenerate codon resulting in the sequence for the mutant strand shown. What was the original amino acid? c. Compare the charges and pl of the mutant peptide and the normal (wild- type) peptide at physiological pH?