4. Draw the number of fragments as well as their sizes as they would migrate on the electrophoresis gel. Write the size of the fragments on the square when you draw them. Ladder Sal I Hae II Eco R1 bp 50,000 24,000 20,000 16,000 10,000 9,000 8,000 7,000 6,000 5,000 4,000 3,000 2,000 1,000 DNA migration
Q: Significance of proteins in CSF and how to determine the cerebrospinal fluid analysis protein.
A: Protein, like the enzymes, blood, and cerebrospinal fluid, may be found in practically all human…
Q: How does NH4SO4 affect water structure? What does this have to do with protein solubility? I thought…
A: One of the factors that determine the solubility of proteins in solution is the concentration of…
Q: 6. When a concentrated alkali solution acts on the purine cycle, it breaks down? A. Ester group B.…
A: Purines are nitrogenous bases composed of two rings, which are fused together. Adenine and guanine…
Q: do aklaloids minic neutrotransmitters in our bidy? amines contain: a) nitrogen atom b) an acid c)…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: 4. What is a "partially hydrogenated vegetable oil"?
A: Oils are nonpolar, unsaturated lipids that are liquid at room temperature. they are hydrophobic…
Q: A 2x10-6 dilution of your bacterial culture yielded 10 colonies. What was the cell density (in…
A: The purpose of dilution of the bacterial culture before plating is to ensure that the cells are are…
Q: Sample Results Remarks Glycine A Egg white B Casein Tyrosine D
A: In a polypeptide chain the amino acids are linked together via peptide linkages.
Q: 4. Enzymes in an enzymatic reaction do not interfere with: a. free energy of reaction b. rate of…
A: Enzymes are the biological catalysts that speed up the rate of reaction by lowering the activation…
Q: When phospholipids are dispersed in an aqueous solution, they will often form more ordered…
A: The phospholipids are the principle constituents of the cell membrane.
Q: Protein denaturation is the disruption of a protein's secondary to quaternary structures. Protein…
A: Denaturation is a process in which proteins or nucleic acids lose their native quaternary, tertiary,…
Q: How many more acetyl CoA are generated from stearic acid than from linoleic acid during beta…
A: The process of beta oxidation of stearic acid yields two distinct products and these are acetyl-CoA…
Q: Biochemistry: Diagram the biosynthetic pathway from precursors (like amino acids, PRPP, etc.) to…
A: There are two pathways for the biosynthesis of nucleotides: de novo and the salvage pathways. In the…
Q: 1. Foods cannot be compared without determining the “per gram" values. Explain the reasoning behind…
A: Nutrients are substances required by the body, for the growth and development, reproduction, and to…
Q: 12 If strong-base anion exchange resin is applied to treat raw water with silicate, the pH of raw…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: Describe the reaction and the products that would occur if transketolase acred upon a pentose aldose…
A: Transketolase is an enzyme of pentose phosphate pathway which accept two carbon from pentose ketose…
Q: . Label each statement about the polynucleotide ATGGCG as true or false. a) The polynucleotide…
A: Polynucleotides are found naturally in all living organisms and play a variety of roles in them. A…
Q: 1. In one (1) sentence point out a key structural similarity and difference in each of the following…
A: There are 4 Biomacromolecules . They are carbohydrates, proteins , lipids and nucleic acids. Each of…
Q: In cholesterol, to which ring of the steroid system is the hydroxyl group attached? B O A
A: cholesterol is a sterol and is the primary compound from which synthesis of many steroid hormones,…
Q: For carbohydrates to be converted to energy, it undergoes the process of metabolism, where in the…
A: Carbohydrates are major energy source of human beings. It is most important component of our diet .…
Q: Which of the following enzyme catalyzes the first step of glycolysis? Group of answer choices…
A: Glycolysis : Process in which the glucose gets broken to produce pyruvate, ATP, NADH and water.
Q: What is the final enzyme used in the biosynthesis of stearate (C18:0)? A. Elongase B.Beta-Ketoacyl-…
A: Fatty acid biosynthesis occurs in the cytoplasm of the cell. Fatty acids are the long-chain…
Q: Look at the structure of the disaccharide shown. Name the type of bond which is present. CH2OH H он…
A: Disaccharides exist in more than one chemical conformational structure. The alpha and beta forms of…
Q: Xanthoproteic Test (+) Millon's Test (-) Pauly Test (+) Biuret Test (-) Which peptide will yield the…
A: Polypeptides are amino acids linked together by peptide linkages.
Q: 4. How does compromised pyruvate kinase activity lead to anemia ?
A: Anemia is a disorder in which the body does not have enough healthy red blood cells to transport…
Q: ANSWER BRIEFLY EACH QUESTION 1. Why is confirmatory test important to perform in different drug of…
A: The question talks about different substance abuse compounds. Right after the screening of drugs the…
Q: Match the items on the diagram with the correct term below. 3' 5' 5 D 8 Activate W DNA Replication…
A: DNA replication is the particular process by which a specific molecule of DNA is being duplicated.…
Q: Explain the four stages of biochemical energy production from food which are part of the typical…
A: The which we consume is composed of nutrients like carbohydrates, proteins, and lipids. After…
Q: of Mg2+.Classify each analyte based on its level in the soil sample
A: Amount of soil sample = 2.65g In mg = 2.65 × 1000 = 2650…
Q: What is the molecular weight of a linear polysaccharide consisting of 7 galactose monomers and 1…
A: Glucose and galactose are monosaccharides that are also referred to as simple sugars. They represent…
Q: A solution has a pH of 5.4. What is its pOH O5.4 8.6
A: The hydrogen ion concentration [H+] and hydroxide concentration [OH–] in a aqueous solution have an…
Q: Make a concept map covering about the following: a. SYPHILIS b. Anti-Streptolysin O Test (ASO TEST)…
A: Hi! Thank you for the question. We are authorized to answer three subparts at a time, since you have…
Q: 7. Describe the falient features and functions of steroids.
A: Steroids are biologically active compounds. Steroids are found in plants, animals and fungi.…
Q: COO co0 C=0 C=0 + CH2 ČH3 COO The name of enzyme that catalyzes above reaction is Select ] and the…
A: Here, a reaction is given in the question and we have to identify the enzyme which catalyzes this…
Q: In olfactory neurons, it is estimated that activation of the olfactory receptors results in an…
A: The olfactory epithelium of the nasal roof contains olfactory receptors. Each olfactory receptor is…
Q: 3- Planning, implementation and evaluation
A: Health Sector is the most important sector of today's world which includes which includes hospitals,…
Q: what transport proteins are involved is getting ca2+ out of cytosol
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: Explain the difference between saturated and unsaturated fats.
A: The chemistry of the triacylglycerols determine their physical properties.
Q: A biological Claisen reaction occurs in the conversion of two acetyl CoA molecules to one…
A: Introduction: The condensation reactions involve the formation of new carbon-carbon bonds. The most…
Q: With basic knowledge and understanding in biochemical energy production now, recall your last meal,…
A: Carbohydrates are composed of carbon, oxygen, and hydrogen which are connected by the…
Q: In the structure of vancomycin, what moiety contributes to its solubility in polar medium?
A: Vancomycin is a glycopeptide antibiotic and kills gram-positive bacteria such as…
Q: (a) Draw the condensed structural formula, and give the name and abbreviation for the dipeptide…
A: Dipeptide is the structure formed by two aminoacids with a single Peptide bond. Anomeric carbon is…
Q: Identify the mRNA codons that could have been used in the protein synthesis process to convert DNA…
A: mRNA is the product of transcription formed from DNA by RNA polymerase. This mRNA is important for…
Q: Which of the following is not a similarity between prokaryotic initiation and eukaryotic initiation?…
A: Translation is a process of Synthesis of polypeptide chain from mRNA template by using Ribosomes. It…
Q: n circulatory system, one the main function of our blood is controlling our body temperature.…
A: Blood is one of the connective tissues that absorbs and distributes heat throughout the body.
Q: The table below summarizes the results for Hopkins-Cole test. Provide the correct remarks from the…
A: The amino acid tryptophan has a side chain containing an indole ring.
Q: calculate the net charge of your peptide at I) pH 2.0; ii) pH 6.0 iii) pH 7.0; iv) pH 11.5. show…
A: Amino acids contain ionizable groups, the ionic form of the amino acids depends on the pH. The…
Q: Question 8 All of the following have terpene structure, except Cholecalciferol Squalene Carotenoids…
A: Terpenes generally are composed of two, three, four, or six isoprene units. Many important terpenes…
Q: Question 3 Aldosterone regulates sodium, potassium, and chloride ions in tissues True False
A: Aldosterone is a hormone which is secreted by the adrenal glands. Aldosterone secretion is increase…
Q: What are the current treatments for Pyruvate Kinase Deficiency (PKD) patients?
A: Pyruvate kinase deficiency is a genetic disorder in which the enzyme pyruvate kinase, which is…
Q: How does NanoDrop quantify DNA?
A: Quantitative analysis techniques are used to measure the quantity of a substance in a solution.…
Step by step
Solved in 3 steps
- A plasmid is a circle of ___ . a. RNA b. DNA c. either RNA or DNA d. histone proteinsLinkage analysis. is used to create a physical map is based on the natural recombination process requires radiation hybrid mapping involves breaking and rejoining of DNA artificiallyMatch each term with the most suitable description. ______ DNA profile a. GMO with a foreign gene ______ Ti plasmid b. alleles commonly have them ______ probes c. unique array of short tandem repeats ______ SNPs d. used to find clones. ______ transgenic e. mouse vs. human ______ genomics f. used in plant gene transfers ______ CRISPR g. based on RNA interference
- 1. An image of a DNA profile is shown below. The size marker fragments are not shown, but the size in bp is displayed along the top. 100 150 200 250 300 350 D8 Identifiler TM k 2000 multiplex STR TH01 1500 D13 D19 D5 VWA ТРОХ D16 CSF AMEL D3 D21 FGA 1000 D18 D7 D2 500 How do the multiplex STR data demonstrate the profile is from a man? Which loci are homozygous? How do you know this? How does the IdentifierTM kit differentiate D19 and D3 PCR products? How does the IdentifierTM kit differentiate D5 and FGA PCR products?y Cours S DIOE The following DNA fragment shows where a number of restriction endonucleases cut sites occur within the fragment. The numbers below indicate the distance between those cut sites in base pairs (bp). Kpn I Sall Eco RI Pst Bam HI Xho Bam HI Pst i Eco RI Kon I 100 200 300 400 500 B00 700 800 900 1000 1100 1200 1300 1400 1500 1600 1700 1800 1900 2000 How many total restriction fragments will result if you complete digest the DNA fragment above with Sal I? cross out a. 1 cross out b. 2 cross out O c. 3 cross out d. 4 cross out e. 5 cross out O f. 6 cross out g. 7 cross out Oh. 8 The following DNA fragment shows where a number of restriction endonucleases cut sites occur within the fragment. The numbers below indicate the distance between those cut sites in base pairs (bp). t of Sal Eco RI Pat Xhol Bam HI Psti Eco RI Koni Kpn i Bam H3. Look at the sequences below. If you add a restriction enzyme(that cuts at GAATTC) to the uncut DNA, how many DNA fragments will result? Circle the fragments. Uncut DNA 1: TGATCGTGGAATTCGATGATCGAATTCGCTAGCTGAATTCAAAAAA ACTAGCACCTTAAGCTACTAGCTTAAGCGATCGACTTAAGTTTTTT Number of fragments: Uncut DNA 2: Number of fragments: Length of fragments: TGATCGTGGACTTCGATGATCGAATTCGCTAGCTGAATTCAAAAAA ACTAGCACCTGAAGCTACTAGCTTAAGCGATCGACTTAAGTTTTTT Uncut DNA 3: basepairs (ignore ends with unpaired bases) Length of fragments: basepairs (ignore ends with unpaired bases) TGATCGTGGACTTCGATGATCGAATTCGCTAGCTGCATTCAAAAAA ACTAGCACCTGAAGCTACTAGCTTAAGCGATCGACGTAAGTTTTTT Number of fragments: Length of fragments: basepairs (ignore ends with unpaired bases) 4. You are given a new sample of DNA that matches one of the uncut samples above (1, 2, or 3). How could you use restriction enzyme analysis to match your unknown sample to one of the known samples (1, 2, or 3)? Explain below.
- The diagram below shows an autoradiograph ofa DNA sequencing gel. Write the 5' to 3' sequence of the template strand based on the pattern in this gel А с G T10. Samples were tested for sickle cell disease by PCR. The results were analyzed by agarosc gel electrophoresis. Lanes I, 3, 5, 7, and 9 are PCR-amplified, but undigested DNA (364 bp), and lanes 2, 4, 6, 8, and 10 are Ddel-digested DNA. Lanes 1&2 are from a known carrier DNA (B^/B", 4 bands). Please, identify the genotype in lanes 3&4, 5&6, 7&8, 9&10. DNA marker 1 2 3 4 5 6 7 8 uents 10 364 bp- 291 bp- 201 bp- bp CKO BA/BsQuestion Image hown bele nallest? Q. A gel from gel electrophoresis is shown below. Which DNA fragment is the smallest? B. Direction of Travel
- ment Lopez Chun 1 1006 is Diego 5. For the following DNA strand, complete the following: a. Write the complementary DNA strand below the strand. 5'-A CCTA CGTTC GACGTA ACCGCAT T-3' 3-T6G AT GCAAG CTGCATT GG C6TAA_5² b. Replicate the DNA strand (remember semiconservative replication). 5'-AC CTA CGTTCGAC GTAA CCGCATT-3' 3'- 5'- 3'- 5'-ACCGTTCGACGTAACCGCATT-3' - 5' 138 DNA and BLAST Lab Report - 3' - 5' OLD NEW NEW OLD c. Transcribe the 5' to 3'DNA to an mRNA strand (remember there is NO thymine in RNA). 5'-A CCTA CGTTCGACGTA ACCG CATT-3' DNA mRNA d. Take mRNA strand and convert to amino acid (protein) using mRNA codon table (Table 4). Remember mRNA is read 5' to 3' so you will need to re-write the sequence to begin with the 5'end. Start protein at the AUG sequence. mRNA Protein1. What are restriction enzymes and what do they do? 2. Complete the chart Original DNA sequence 5' TGA CCA CTC GAG CAT AAC GAG TCG CTC 3° Write the complementary strand's sequence * remember it will be opposite directionality (the number at the ends are different) * pairs are A-T and C-G |Copy and paste your double stranded DNA into this box. You are going to use the restriction enzyme Xhol. Mark the cut site by changing the color (highlight or change text color) of one double-stranded piece * it cuts between the C and the T (cut shown as slash symbol): 5’ C/TC GAG 3' * remember it cuts BOTH strands (the restriction site is palindromic). Hint: read each strand in the 5'à 3' directions to find the cut sitea 1. Shown here is a Holliday junctionWhich cut and resolution will result in recombination? d 2. In genetics lab, 2 students infected a samnle of bhacteria with a virur