30. Which of the following is true? A. Both DNA and RNA contain uracil B. Neither DNA or RNA contain uracil C. RNA contains uracil D. DNA contains uracil

Q: The table below summarises the three stages of Meselson and Stahl's experiment and their results. (a...

A: While proposing the double helical structure of DNA Watson and crick had immediately proposed  for r...

Q: Which of the following characteristics of a water-insoluble substar nost important in governing its ...

A: Answer  C) lipid solubility  

Q: Below is a short segment of DNA molecule. transcribed the DNA codon into mRNA. TACCATGAGAATTGTGGTCAC...

A: Convertion of TACCATGAGAATTGTGGTCACCTTTTT ATGGTACTCTTAACACCAGTGGAAAAA to mRNA is done and results ar...

Q: If the a and b loci are 40 cM apart and an AABB and aabb individual mate: What gametes will the F1 i...

A: The recombinants means the individual form by combination of two different alleles other than parent...

Q: How Would You Farm?

A: Farming is the practice of growing crops or raising cattle in a large area. It involves strong inter...

Q: Answer and explain comprehensively. 3. If humans evolved from apes, then why are there still apes?

A:      INTRODUCTION          Evolution is a main thing happened by a natural process that mainly occur...

Q: Highlight the answer or write it in short sentences

A: A phenotype is the physical expression of DNA. In contrast, the genotype is the chemical make up of ...

Q: A testcross is a way to determine_______ . a. phenotype b. genotype c. dominance

A: Testcrossing and backcrossing are used to identify unknown genotypes with known phenotypes. When one...

Q: Briefly discuss the cardiac cycle. Include what occurs in the atria and the ventricles, oxygen amoun...

A: The heart is a muscular organ that pumps blood through the blood vessels of the circulatory system s...

Q: Hello, good day. I have a problem answering this question, and I need your help. Hoping for a respon...

A: The hereditary material in humans and almost all other organisms is DNA or deoxyribonucleic acid. Th...

Q: Enumerate 5 important features of the DNA. Choose ONE from your list and elaborate on how this feat...

A: Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains that coil around each ...

Q: A 5-month-old girl is brought to the emer- gency department by her parents because she is "turning b...

A: This is a classical presentation of a congenital heart disease known as the Ventricular Septal Defec...

Q: Disorder of Sex Determination Now that you have reviewed typical sexual determination in humans, it ...

A: Swyer syndrome  It is an uncommon disorder that causes the sex glands (testicles or ovaries) to fai...

Q: Provide consequence or outcome of eugenics

A: Introduction Eugenics:- Eugenics is the selection of desired heritable characteristics in order to i...

Q: One of the major findings of this study is that GTP arrests the enzyme. Draw (i) the natural substra...

A: Enzymes boost the rate constants of chemical reactions that would otherwise be hundreds of times slo...

Q: What kind of domain is involved with intracellular signaling, cytoskeleton remodeling, and are able ...

A: Pleckstrin homology domain is a protein domain consisting approximately 120 amino acids. 

Q: A bacterial cell undergoes a change and the two Trp codons of the tryptophan leader sequence are con...

A: Tryptophan operon is an example of repressible operon which remain transcriptionally active and beco...

Q: There are two groups of drugs classified as antagonists of histamine receptor antagonists. The one g...

A: The drug : histamine receptor antagonist Two groups of the drug:  Blocks activation of histamine2 (...

Q: With the aid of a diagram, describe the structure of a flexible endoscope capable of carrying out mi...

A: different parts of a common endoscope: UP/DOWN Angulation Control Knob. RIGHT/LEFT Angulation Contro...

Q: If a person reaches a BAC of 0.060% and then stops drinking, we would estimate that all alcohol woul...

A: Introduction :- Blood alcohol levels are decided by the blood alcohol concentration calculator . It ...

Q: Illustrate the basic structure of chromatin ?

A: The basic structure of chromatin is known by the name of the nucleosome. The chromatin can either be...

Q: . A solute cannot move into a cell by crossing the phospholipid bilayer of the membrane. It can, how...

A: Answer The solute molecular are hydrophilic 

Q: What is thermal death time? What are the factors that may influence the efficiency of chemical growt...

A: Answer 1 :- Thermal death time is the way lengthy it takes to kill a particular bacterium at a parti...

Q: Describe and explain the necessary changes that health systems worldwide must undergo to improve ada...

A: Introduction :- Healthcare system is a system consisting of institutions ( like hospitals, dispensar...

Q: Describe how an individual's genotype influences their chance of contracting malaria: Which individu...

A: Malaria is an infectious disorder due to the malarial parasite, Plasmodium falciparum. it's miles tr...

Q: 1. What are the pre-analytical phase in doing the Direct Fecal Smear? 2. Discuss the Cleaning and D...

A: Direct Fecal Smear is done for checking the presence of bacteria and parasites. 

Q: 35. What type of junction allows for molecules to pass between adjacent cells? A. Gap junction B. De...

A: Introduction: Cell junctions are cellular structures comprising of multiprotein complexes. They prov...

Q: Design a set of experiments using chimeric proteins, composed of a mitochondrial precursor protein f...

A: Methotrexate acts as a substitute for the enzyme dihydro folate reductase ( DHFR). This is a DHFR co...

Q: How did the work of each of the following scientists—Garrod, Beadle and Tatum, and Pauling— contribu...

A: Gene can be described as the unit of heredity that comprises the information related to the generati...

Q: Basis of Comparison DNA RNA 1. Number of strands 2. Location in the cell 3. Type of sugar 4. Nitroge...

A: DNA is the genetic material in all living organisms that is responsible for the production of RNA by...

Q: Explain the arm abduction and adduction at the shoulder joint together with the respective muscles i...

A: Movements in general at synovial joints are divided into four main categories i.e Gliding movement, ...

Q: what are the metabolic and physiologic capabilities of proteus Vulgaris? describe the different type...

A: Bacteria are ubiquitous, mostly free-living organisms. They often consist of a single biological cel...

Q: 1 11 9 10 Study the pedigree diagram of a sex- linked trait above and answer the following questions...

A: X-linked trait  The trait or phenotype which is transfer with X- chromosomes are known as X-linked t...

Q: What are the techniques in solving pedigree problems?

A: Techniques of solving pedigree problems:- A step wise guide to mastering pedigree questions: - Firs...

Q: In a compound microscope consisting of a 5 mm objective lens and an eyepiece (2.5 cm) eyepiece, an o...

A:

Q: The following is a difference between eukaryotic and prokaryotic gene regulation: O Only prokaryotes...

A: 1. Operons occur primarily in prokaryotes but also in some eukaryotes, Operons are very rare in euka...

Q: Which of the following occurs in Huntington's disease? The cells of the substantia nigra die and no ...

A: Huntingtons disease is disease condition when nerve cells are damaged or break down over a time.It b...

Q: Layer that is pigmented by melanin D

A: The skin of humans is the outer covering of the body. It is the first line of defence for foreign bo...

Q: Discuss how enzymes proofread and repair errors in DNA.

A: Errors in various cell processes are repaired by a group of damage repair mechanisms known as DNA re...

Q: 1. Describe what malaria is and where it is prevalent in what areas of the globe and in what habitat...

A: Often diseases are caused by various pathogenic microbes that are found in unhealthy and unhygienic ...

Q: What do you think would happen to the mouse population if the number of fox predators, such as wolve...

A: Nothing will happen according to the options available in the question.

Q: How might gene flow between populations living in different habitats actually interfere with each po...

A: Answer 

Q: Define about Chromosome Territories ?

A: Chromosomes are condensed thread-like structures found inside the nucleus of eukaryotic cells. It is...

Q: Stomach 4x or  10x label lumen , simply columnar epithelium gastric pits mucosa layers , submucosa m...

A: Introduction: Stomach is a J-shaped muscular, bag-like organ of the digestive system. It is located ...

Q: what components makes a test effective?

A: Testing effectiveness It refers to the effectiveness of how testing is performed or how the goal is ...

Q: Transphosphorylation of receptor tyrosine kinases:        activates JAK2       inhibits catalytic ...

A: Transphosphorylation of receptor tyrosine kinase activates JAK2.

Q: Because of risk of solanine poisoning, you should not eat the leaves, stems, or any part but the kno...

A: Solanine can be referred to as a colorless, alkaloid compound. It comes under the category of glycoa...

Q: A chest x-ray exposes you to roughly 40 millirems of radiation. How many chest x- rays would you nee...

A: Option (b) the radiation can cause chemical changes in the food.

Q: In the Hershey–Chase experiment, the radioactive label 32P was present inside bacterial cells (i.e.,...

A: DNA is an organic molecule that transmits information from generation to generation. Several experim...

Q: When is fluorescence used in a clinical laboratory?

A: Fluorescence is a type of photoluminescence where light is absorbed by an excited molecule or atom a...