3. Supra-secondary structures of proteins - supercoiled alpha- helix, Greek key, meander, interlock, roll, beta-hairpin. Draw (schematically) these structures.
Q: Using an arrow, draw the site of cleavage for the following peptides that are reacted by: Pepsin…
A: Amino acids are building blocks of peptides and polypeptide chain. Peptides are consist of 2-50…
Q: 385 What acts as a reductant in the glutamate synthase reaction to catalyze the transfer of the…
A: Reductant is a substance that donates electrons to another substance and reduce it. In an…
Q: For the amino acid arginine: Draw its complete protonic equilibria. Indicate the net charge of each…
A: Zwitterionic form is a form of molecule which has a net charge of zero.Also this form is very…
Q: Name the three major types of membrane lipids in animal cells and provide a specific example of…
A: The cell membrane is composed of lipids and proteins. A small amount of carbohydrates is also…
Q: A biosynthetic pathway for the synthesis of two molecules, E or H, from molecule A is shown below.…
A: Enzymes can e reversibly inhibited in presence of competitive and non-competitive inhibitors. Such…
Q: The acetyl group shuttle transfers the acetyl group of acetyl-CoA, produced by oxidative…
A: Acetyl CoA is produced in mitochondria and cannot leave mitochondria so it combines with…
Q: discuss the biochemistry behind disorders related to aromatic amino acids with the aid of an…
A: Metabolic disorders are caused due to abnormalities in one or more processes in a metabolic pathway.…
Q: Which of the following is not true about the properties of a peptide (amide) bond? a.The bond…
A: A peptide is a polymer of amino acid residues linked together via a peptide bond. The peptide bond…
Q: 1. What is the sequence of the heptapeptide produced upon treatment with trypsin? Fill each blank…
A: Specific enzymes have specific cleavage point in amino acids. Chymotrypsin is serine…
Q: Question 21 of 25 What are Gram-negative bacteria? Select the correct response(s): They have a cell…
A:
Q: Why do some starch products set as they cool?
A: Introduction Starch is a carbohydrate which is commonly found in nature like wheat, rice, potatoes…
Q: What is the meaning of "in vitro"?
A: Biochemistry is an attempt at explaining the living cell in chemical terms. A living cell is the…
Q: 6-31 You do an enzyme kinetic experiment and calculate a Vmax of 100 If each assay used 0.1 mL of an…
A: Turnover number is the number of substrate molecules transformed into product per minute by one…
Q: Tube 1: Add 1 mL 5% Trypsin Tube 2: Add 1 mL 5% Trypsin and 2 mL of 0.5% Na2CO3 Solution Tube 3: Add…
A: Trypsin is a proteolytic enzyme that cleaves the peptide bonds in protein and releases individual…
Q: Studies of a specific enzyme activity showed that the time the enzyme activity before complete…
A: An organic substance called an enzyme acts as a catalyst for a biological reaction. Each cell in the…
Q: Which of the following statements is CORRECT? A) Hexokinase IV is allosterically inhibited by…
A: Enzyme plays an important role in all the metabolic activities in our body. They themselves remain…
Q: How many of the following statements are true? Allosteric enzymes display sigmoidal kinetics for…
A: Allosteric enzymes are enzymes that possess additional binding sites known as allosteric sites.…
Q: Chemistry Most of the reactions in gluconeogenesis are the simple reversal of the ‘forward’…
A: In gluconeogenesis pathway, the formation of phosphoenolpyruvate from oxaloacetate is catalyzed by…
Q: It is obtained from the milky secretion of various plants such as the tree Hevea brasiliensis.…
A: Hevea brasiliensis, the Para rubber tree, or most commonly, rubber tree or rubber plant, is a flower…
Q: 8. Why is it important to maintain blood glucose during exercise? How is this achieved?
A: During exercise, it is important to maintain glucose homeostasis. There is a tight regulatory…
Q: In the free energy diagram below, molecule A (with energy x) is converted to molecule B (with energy…
A: Activation energy for a reaction is the minimum amount of extra energy that is necessary for the…
Q: In gluconeogenesis, how is glucose-6-phosphate converted to glucose? is converted to glucose by…
A: Gluconeogenesis is a metabolic process that converts non-carbohydrate carbon substrates such…
Q: What is dideoxy sequencing? Explain it please.
A: Introduction DNA or deoxynucleotide acts as genetic material in our body. DNA contains nitrogenous…
Q: What volume of a 0.8 M glucose solution can be made from 50 mL of a 2M stock solution?
A: Stock solution is the given solution present in lab. From the stock solution, we make the working…
Q: What would be the standard free energy change if FADH 2 is used to reduce O 2 to water? Standard…
A: Biological oxidation-reduction reactions involve the transfer of electrons from one biomolecule,…
Q: 13. Linear regression analysis was performed for the calibration standard data set based on this…
A: Concentration of any unknown sample can be found out from a standard curve. The standard curve is…
Q: Identify the major and minor grooves in the DNA molecule PDB ID 141D. In addition, one end of a…
A: DNA is two strands of polynucleotide linked to each other in an antiparallel direction by hydrogen…
Q: Discuss the role of carbohydrates on cancer and suggest an appropriate treatment
A: Carbohydrates are biomolecules, which are the primary source of energy for the body. All of the…
Q: Consider the malate dehydrogenase reaction from the citric acid cycle. Given the listed…
A: Malate dehydrogenase catalyses the reversible conversion of malate (MAL) to oxaloacetate (OAA),…
Q: d) Cleavage by trypsin followed by gel-filtration chromatography gives the expected 6 products,…
A: Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts…
Q: Describe the signal transduction pathway for Two or Three of the following: a) ß-adrenergic…
A: Beta adrenergic receptor is a G-protein-coupled receptor communicating through the Gs alpha…
Q: Chemistry When the steady-state concentration of a drug on one side of the membrane is 5 micromolar…
A: According to Fick's first law, dC/dt= K(C1-C2)/h
Q: What effect is seen on a Lineweaver-Burke graph when a competitive inhibitor is added to an…
A: Competitive inhibition is an enzyme inhibition process where an inhibitor molecule (similar to the…
Q: 1. What two enzymes in glycolysis are regulated by high ATP concentrations?
A: INTRODUCTION : Glycolysis : It is a metabolic pathway in which glucose is breaken down into pyruvate…
Q: Given 2 M Tris, pH 7.1 (pKa 8.0), 5 M NaOH, 5 M HCI, and water; how would you prepare 2 L of 0.2 M…
A: Equation of dilution: M1V1 = M2V2 where: M1 is the molar concentration of the stock solution. M2 is…
Q: How many cycles of the synthesis pathway are needed to produce lauric acid, C₁1H23COOH? ||…
A: The production of triglycerides from acetyl-coenzyme A (acetyl-CoA) subunits is known as…
Q: A Biuret test is a chemical test used to determine the presence of a peptide bond in a substance.…
A: The biuret test detects the presence of proteins in a sample solution. The copper ions in the biuret…
Q: Initiation of transcription in prokaryotic cells requires not only RNA polymerase, but also an…
A: The sites of transcription on the DNA has three main regions viz., promoter region (upstream of the…
Q: QUESTION 5 Oxaloacetate Acetyl-CoA AG" = -7.7 kcal/mol COA Citrate Fatty acids AG"=-1.5 kcal/mol…
A: Free energy change (∆G) of a reaction helps to find the spontaneity of a reaction. Negative ∆G of a…
Q: 1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG mRNA: Codon: Anticodon: Amino Acids: 2. DNA:…
A: During the process of transcription, one strand of the DNA act as the template for the synthesis of…
Q: Question 20 of 25 The figure below illustrates what reactions of amino acids? coo C=0 CH₂ CH₂ =0 00…
A: Amino acids are the building blocks of proteins. they exhibit different physical and chemical…
Q: What are the components of a nucleotide? Provide 1- or 2-sentence description of each component.
A: Nucleic acids are biomolecules that are essential for all life forms. They are polymers of…
Q: What is the difference between starch and cellulose that makes one digestible and the other not…
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: In an Absorptive (fed) state Which predominates? Anabolic or catabolic processes? Which ones…
A: Metabolic pathways are a series of process which includes chemical reactions occurring in a cell.…
Q: Which of the following is NOT true of a competitive inhibitor? A) Its effects can be overcome by…
A: Competitive inhibitor- It competes with the substrate for the active site of an enzyme, while the…
Q: Describe how a protein’s structure determines its function. What determines a protein’s structure?
A: Proteins have four levels of conformations known as primary, secondary, tertiary, and quaternary. In…
Q: Discuss how to determine the elements of proteins and its reactions.
A: Proteins are the most abundant biomacromolecule of life. Proteins are primarily polypeptide…
Q: Η Η Η Η Η ΤΙΤΙΤ H-C-C-C-CC-G | | | | | Η Η Η Η Η I ОН
A: A functional groups are is a group of atoms that bonds within a molecule and is responsible for the…
Q: Indicate whether the following pairs of monosaccharides are aldoses or ketoses. a. D-altrose &…
A: INTRODUCTION : Monosaccharides : They are also known as simple sugar. They are the simplest forms of…
Q: Which of the following is NOT a naturally-occurring amino acid? A) B) C) D) H₂NCH-COO CH3 H₂NCH-COO…
A: The proteins are composed of twenty naturally occurring amino acids. These amino acids are alpha…
Step by step
Solved in 2 steps with 7 images
- 1. Hydrogen bonds can form an alpha helix or beta sheet. The hydrogen atom has a partial positive because of the atom it is covalently bound to. Name the two most common atoms hydrogen bonds within biological systems that give hydrogen a partial positive charge. 2. Are the atoms named in the question above in the backbone of the protein or are they found in R groups? Which R groups? 3. Besides hydrogen, what other atom is involved in the hydrogen bonds in an alpha helix or beta sheet? In other words, hydrogen is interacting with what other atoms when it makes a hydrogen bond? 4. Write out, in order, the full names of the seven amino acids circled in the picture.1. The ribosome is a good representation of what level of structure of nucleic acid? 2. What is the meaning of dADP?4. A polypeptide comprised of 17 amino acid res- idues with the sequence on the right is ob-served by spectroscopic methods to undergo transitions from an a-helix conformation to a B-sheet as a function of pH and concentration. The acetyl and carboxamide groups are attached covalently to deri- vatize the N- and C-terminal residues, respectively, to avoid charge effects of the end groups. CH3CO-ΤAΤΚΑE LLAKYEATΗK-CONH2 (a) ( amino acid residues. Write the sequence of this polypeptide with corresponding 3-letter abbreviations for the (b) At pH < 4 the polypeptide forms an a-helix. (i) ( the helix? and (ii) (: · with respect to the positive and negative ends of the macrodipole? ) What is the direction of the macrodipole of | Are the charges on the N- and C-terminal residues stabilizing or de-stabilizing (c) (* stabilize the helical conformation. What are the most likely protonation states of the side-chains that provide a-helix stabilizing interactions? Use the helical wheel (at the back…
- 5. Indicate whether the following amino acid residues would be more likely to be found on the surface or in the interior of a folded protein: Leu, Arg, Phe, Asn, and Glu. Give your reasoning for each case (diagrams not required).11. A polypeptide is making a short a-helix. A typical residue in an a-helix is involved in two H-bonds. At a minimum, how many residues this helix could have?4. A polypeptide comprised of 17 amino acid res- idues with the sequence on the right is ob-served by spectroscopic methods to undergo transitions from an a-helix conformation to a B-sheet as a function of pH and concentration. The acetyl and carboxamide groups are attached covalently to deri- vatize the N- and C-terminal residues, respectively, to avoid charge effects of the end groups. CH3CO-ETATKAELLAKYEATHK-CONH2 (а) amino acid residues. Write the sequence of this polypeptide with corresponding 3-letter abbreviations for the (b) At pH < 4 the polypeptide forms an a-helix. (i) the helix? and (ii) with respect to the positive and negative ends of the macrodipole? What is the direction of the macrodipole of Are the charges on the N- and C-terminal residues stabilizing or de-stabilizing
- 3b) Both a-helical 2° structure and b-pleated sheet 2° structure result from the same type of interaction; briefly explain in your own words why you might observe an a-helix in one region of a protein and a b-pleated sheet in another region of the same protein.8. The following proteins represent a wide range of molecular weights and isoelectric points. Mr is the molecular weight of a single protein chain. • Protein 1: Mr 68,544; pl 6.11 (monomer) • Protein 2: Mr 29,041; pl 5.32 (dimer) • Protein 3: Mr 15,805; pl 5.7 (dimer) • Protein 4: Mr 12,165; pl 4.74 a. Which protein is the most acidic? Explain your answer. b. Which protein will migrate the slowest in an SDS-PAGE? Explain your answer. c. In what order will these proteins elute from a cation exchanger at pH 8? Explain your answer. d. In what order will these proteins salt out from a pH 7 solution by the dropwise addition of saturated ammonium sulfate? Explain your answer. 83°F 立3. β sheets are less likely to form than α helices during the earliest stages of protein folding. Explain why this is the case. (hint: think about the hydrogen bonding requirements).
- 5. Bread contains mixture of polypeptides known as gluten. This polypeptide has two types which are gliadins and glutenins. If both polypeptides have presence of short a-helix sections because of high proline content, what level of protein structure is being depicted? 5a. If intermolecular bonds form between glutenin and gliadin, what level of protein structure is being depicted? 5b. During analysis, hydrophobic amino acids (i.e., glutamine and proline) were not found on gluten protein surfaces. In this case, what level of protein structure is being shown?4. Do the "Bond X" bonds in Figure 4 involve atoms in the amino acid R groups or in the polypeptide "backbone"/ "main chain" atoms? 5. Given Your Answer To “b," are each of the following statements True or False? Be able to explain your reasoning. o Only very specific primary sequences can form a-helices and B-sheets. o Many different primary sequences can form a-helices and B-sheets. Each arrow depicted in Figure 4D represents consecutive amino acids in the primary sequence of the polypeptide, while the different arrows may be formed from amino acids that are removed from each other in the primary sequence. Each arrow is referred to as a B-strand, and the structure formed through interaction of the B-strands is the B-sheet. In a complete protein, other segments of the protein would connect the different B-strands. 6. Do the "Bond X" bonds in the B-sheet connect atoms from the same B-strand or neighboring strands? TERTIARY STRUCTURE (A) (B) (C) Figure 4-17 Essential Cell Biology 3/e (o…3a) Secondary (2°) structure in proteins refers to two specific conformations a region of a protein can take on, the a-helix and the b-pleated sheet. Briefly describe or explain how 2° structure forms/what causes 2° structure to form in a region of a protein.
