Q: (i) (ii) Draw the potential tautomers of guanine. Explain the potential risk of guanine (enol form)…
A: (i)The potential tautomer of Guanine is-
Q: In what part of hemostatic mechanism do the factors participate a. thrombomodulin b.…
A: Hemostasis is the process in which blood coagulates or clots. There are several factors or blood…
Q: Figure 5. Skin of Tomato under LPo. Type of simple permanent tissue:
A: Tissue is a group of cells that have similar structure and perform function together as a unit.
Q: (iii) What is the function of the promoter in the bacterial operon?
A: The lactose operon (also abbreviated as the lac operon) is a group of genes present in E. coli and…
Q: in 3 5% Shown below is a schematic diagram showing a 3000 bp region of yeast genomic DNA. (Note:…
A: DNA: The hereditary substance in humans and almost all other animals is DNA, or deoxyribonucleic…
Q: which is an example of an evolutionary explanation (as opposed to a functional explanation)?
A: * An evolutionary explanation will states that what evolved from what. *For example humans evolved…
Q: 1. A motor unit is a functional unit formed by a neuron and all the muscle fibres it innervates. II.…
A: The spinal cord is the place where motor neurons are located. It is the site of interneurons and…
Q: What theory about the evolution of humans did the mitochondrial phylogeny study provide evidence…
A: Mitochondrial DNA or mtDNA holds great use in evolutionary studies because it is highly conserved,…
Q: What are the important highlights in transport mechanism? Explain in 5 sentences.
A: Membrane transport mechanism are the mechanism which evaluates how the material or substances are…
Q: Identify whether the following statements are True or False. Answer it all. 4. Fertilization…
A: The union of male and female gametes is known as fertilization. It results in production of zygote.
Q: Ribosome is where the Process of translation takes place Process of moving DNA to the cytoplasm…
A: Ribosomes are made up of both proteins and RNA. These are a part of translational machinery present…
Q: (i) Draw and explain how SPO11 can generate double strand breaks. (ii) What would be the…
A:
Q: What is the difference between the first steps of DNA sequencing to PCR in terms of the number of…
A: PCR or polymerase chain reaction is used to amplify the DNA sequence. Since DNA polymerase amplifies…
Q: The majority of systemic reaction to local or regional analgesic are due to intravascular injection.…
A: ANSWER) TRUE The most cause for the systemic reactions to local analgesics is due to the IVs i.e…
Q: 5. Sexual and asexual reproduction in plants are called , respectively. a. plant meiosis and plant…
A: Reproduction in plants can take place via sexual as well as asexual. Asexual reproduction produces…
Q: Figure #2: The Calvin Cycle (this represents three turns of the cycle) Answer the following…
A: The Calvin cycle is a process that plants and algae use to turn carbon dioxide present in the air…
Q: What is the purpose to have hundreds of DNA double strand breaks (DSBs) created by SPO11?
A: Meiotic recombination is a process that increases genetic diversity and is a crucial part of sexual…
Q: Summarize what is occurring in the initiation phase of transcription. For this answer don’t worry…
A: The initiation stage of transcription is formation of first nucleotides in the RNA chain. This phase…
Q: The translation of an mRNA begins with the codon AUG, and an initiator tRNA is required to start…
A: The ribosome starts translation, the assembly of a protein out of amino acids, when it encounters…
Q: : Which of the following choices is the most appropriate for Which of the following choices is the…
A: Regional block used as anesthetic technique. This is used to inhibit nerve transmission to…
Q: If the AMP was mistakenly left out of the LB/AMP/X-gal/IPTG agar media E. coli cells transformed…
A: *NOTE: Kindly repost for other question Dear Student as per the guidelines we are supposed to answer…
Q: Assume that the TA prepared a negative control (A sample produced from a certified non-GMO food). If…
A: GMO These are genetically modified organisms that have their DNA manipulated through the techniques…
Q: 8
A: *The ovary is an organ can be found only in females which contains many ovum. *Ovaries will secretes…
Q: ID this fish
A: Fishes are vertebrates that prefer to live in aquatic habitats. These respire from gills and lack…
Q: M1, M2, M3, M4 receptor are present belong with; O muscarinic receptors O Adrenergic receptors OG…
A: Muscarinic receotors are type of G protein coupled receptor. It involves in parasympathetic…
Q: QUESTION 3 have dental formulae of 2-1-3-3 and primitive nasal anatomy similar to non-primate…
A: Man is a product of evolution. As a result, human evolution is inextricably linked to the genesis of…
Q: 1. Sephadex G100 is (a) a carbohydrate polymer, (b) used to isolate lectins, (c) is the stationary…
A: Sephadex is a type of dextran used in : Protein chromatography Gel filtration Affinity…
Q: Describe the functions of the following proteins during DNA replication (i) Polymerase epsilon (ii)…
A: The DNA replication is the process by which new DNA is synthesized from the old DNA. This process…
Q: 18) Which of the following statements concerning types of muscle fibre are correct? 1. Three types…
A: Introduction Muscle Fibres:- A muscle fiber is a single cell made of a bundle of myofibrils,…
Q: first 20 amino acids of the CFTR protein?
A: CFTR is Cystic Fibrosis transmembrane Regulator Protein is an important protein that maintains the…
Q: make a flow chart of a drug and show its metabolism noting if there are active metabolites where…
A: Drug metabolism occurs primarily in liver. Although drug is inactivated by metabolism, some drug…
Q: Considering a normal self cell, what might you expect to find in MCH I molecules on the cell…
A: MHC class I molecules (MHC-I) are cell surface recognition elements expressed on virtually all…
Q: Please compare and contrast the anatomy of the heart in a) most reptiles (turtles, snakes, lizards)…
A: Difference between Avian heart and Reptilian heart. S. No. Differential characters Bird's Heart…
Q: QUESTION 6 Monoclonal antibodies are specific for? O a. Single epitope O b. Pair of epitopes O c.…
A: Antibodies or immunoglobulins are synthesized and released from B-lymphocytes or B-cells. They are…
Q: when it comes to cardiovascular toxicity it is mainly manifested by bradycardia and low blood…
A: Cardiotoxicity is a condition when there is damage to the heart muscle. As a result of…
Q: when the patient does not manifest any sigh of paresthesia after mandibular block we can explain…
A: ANSWER;- d) a and b Explain;- A mandibular nerve block is a methodology to numb the lower jaw…
Q: Bacteria was grown in glycerol and induced with the inducer IPTG. Explain the mechanistic steps…
A: The lac operon is the part of DNA which is responsible for break down of lactose into glucose and…
Q: 4G 4G 11:20 1 5 ← Input title May 1 11:20 PM Sun 329 words 14. READ CAREFULLY!!! From the list…
A: Answer 1) the one that is a +/+ relationship is : c) mutualism. mutualism is the interaction…
Q: Summarize the two steps below AND indicate the specific location within a cell where each.…
A: DNA DNA is a long polynucleotide chain containing information about polypeptide chain.
Q: Cause and Effect Determine the effect (increase, decrease, no effect or cannot be determined) of the…
A: * Salt is used in process of DNA extraction because salt it will neutralizing DNA that makes them…
Q: Compare and contrast the role of promoter and operators with enhancers and repressors.
A: Nucleus is a main controller of the cell which carries genetic instructions . It contain thread like…
Q: 21) The Sliding Filament Theory agrees with which type(s) of muscle contraction produced by a muscle…
A: Sliding filament theory suggests the muscular contraction mechanism. As per this theory, moter…
Q: The lac operon is an inducible operon. What does this mean?
A: Operons are the groups of genes related to a single pathway and controlled by a single promoter.…
Q: Enumerate facts about Covid 19
A: Coronavirus disease (COVID-19) is a viral infection caused by the SARS-CoV-2 virus. The majority of…
Q: The final step in gene expression is protein synthesis or
A: Gene expression occurs when the information encoded in our DNA is turned into instructions for the…
Q: QUESTION 10 Cystic Fibrosis is caused by a mutation in a protein called? a. Insulin O b. Amyloid O…
A: Cystic fibrosis transmembrane conductance regulator protein is basically formed by the instruction…
Q: 17. The Brugada syndrome is an autosomal dominant disease with 30% penetrance. If Jim suffers from…
A: Few points about autosomal dominant inheritance : Trait should not skip generation . An affected…
Q: Besides CFTR, what othe gene is associated with cystic fibrosis?
A: Introduction Cystic fibrosis:- It is an inherited disorder that causes severe damage to the…
Q: Describe ways to achieve post-transcriptional control of gene expression
A: Transcription is the process in which RNA is transcribed with the help of the DNA template. In the…
Q: Question 3C How would gas exchange and distribution of oxygen throughout the body be affected if…
A: *Blood moves from heart to lungs through pulmonary artery and in the lungs blood will be supplied…
Step by step
Solved in 3 steps
- 1-ZA: MICROBIOLOG X Gyes or no Measles is an ex x a A https://docs.google.com/forms/d/e/1FAIpQLScarFK5blZrF4szvrYJcXtBP9s_fgUvBMwqmKjcBQTvY5CaFQ/formRespc Which of the following is TRUE regarding bacteria? Bacteria help produce vitamins in our digestive system Bacteria help clean our intestinal walls and help digest food Bacteria are involved in the production of a variety of foods we consume All of the above are true Which of the following statements concerning viruses and human health is 1 false? in many diseases caused by viruses, the virus attacks cells as it reproduces many viral diseases can be controlled through vaccinations some viruses can remain dormant in the body for years before disease symptoms appear most viral infections are difficult to treat, but they can be finally destroyed by antibioticsA elearn.squ.edu.om/mod/quiz/attempt.php?attempt3D1335328&cmid%3D697149 E-leaming System (Academic) estion 19 Which of the following bacteria contain "Endotoxin" as an important constituent of its structure? ot yet swered Select one: arked out of O a. It is present in both O b. Gram positive bacteria Flag question O c. Fungi O d. All answers are correct O e. Gram negative bacteria stion 20 In our bodies, food is broken down into smaller molecules by catalytic enzymes in the digestive tract to allows yet for easy absorption of nutrients by cells in the intestine. vered Oat bran proteins for example, are broken down by pepsin enzyme, by which reaction does this process happen and which chemical bonds will be broken down? ked out of ag question Select one: O a. Dehydration, covalent bonds O b. Hydrolysis, hydrogen bond Oc. Condensation, peptide bods O d. Hydrolysis, covalent bonds O e. Dehydration, hydrophobic interactionsO SC myEFSC с ← > C O Search the webHelp me, please! I wish I have a lot of time to do it by myself ... This is the article link and a microbiology open Stax book link for chapter 16 terms. Please help me to find answers. https://piercemil.instructure.com/courses/2180982/assignments/24927088 https://openstax.org/books/microbiology/pages/15-2-how-pathogens-cause-disease#OSC_Microbio_15_02_Invasion Questions: If possible please write the pg of an article with related Answers; it will be easier for me to describe in detail. Thank You for Helping me. Using the terms found in the “Patterns of Incidence” subsection in Chapter 16, what pattern of incidence best matches the outbreak described in the article? Using the terms found in the “Pioneers of Epidemiology” subsection in Chapter 16, which discusses “spread”, what type of spread of the pathogen best matches the outbreak described in the article? Be specific. What type of epidemiological study was used to identify the source of the pathogen in the article? Be specific.…P 9:12 docs.google.com a 9% לש * ZAIN IQ Iı. نقطة واحدة The membrane surrounding and protecting the cell Cell wall Cell membrane Capsules نقطة واحدة Include several types of protein toxins and enzymes produced and/or .secreted from pathogenic bacteria Siderophores Endotoxins Exotoxins نقطة واحدة The first scientist to draw microbes under a microscope Arthur Hassall Ferdinand Cohn Robert Kochom/webapps/assessment/take/launch.jsp?course_assessment_id%= 498749_1&course_id%3= 111786 1&content id3= Ac... Customize Links Free Hotmail Windows Windows Media Imported From IE Importe Differential . QUESTION 4 What do you do in between each streak on a streak plate? Dip the loop into the culture□ (24) X Fit 2 esentation/d/1hGQUjqTbWbvuj425jU5lzXxy303Sd58V1acYG-145yk/edit#slide=id.gcdc5ff1ec7_0_310 W S OFMovies | Watch C.... Welcome - Blackb.... FMovies | Watch R... 123Movies - Watc... Copy of Copy of Evolution - Cladogram Construction Chordates Do mat Slide Arrange Tools Extensions Help ADO F2 Head X X Click to add speaker notes # 3 Outgroup: spider 80 F3 E Feathers: cardinal D tWatc x C Backbone: lizard $ 4 Another way to visualize a cladogram is with a Venn diagram. This is a nested set of circles where each group within the circle has the characteristics of each circle. An OUTGROUP is a single organism that sits outside the diagram. Q F4 R Gminni X M Inbox X FL Talons: eagle Background % 5 V Note: Eagles have talons, feathers, and a backbone. I F5 T G ^ 6 Layout Theme B eagle A- F6 MacBook Air Y B Clad X H & 7 N cardinal F7 GLOF X Transition U * 8 DII FB - lizard M ( 9 b Figur x b Sear x K Login E DD F9 spider 0 Voxco Agent - Log.... G La fascinante hist... < ) 0 L 5.…This is a figure from a recent paper comparing different bacterial pathogen strains. What is being compared in this figure? 810 820 830 ATCAAACAGGATTAGATACCCTGGTAGTCCACGC ATCAAACAGGATTAGATACCCT GGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACC AGCAAACAGGATTAGATACCCTGGTAGTCCACC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC ATCAAACAGGATTAGATACCCTGGTAGTCCACAC Staphylococcus aureus Staphylococcus epidermidis Enterococcus faecalis Streptococcus pneumoniae Escherichia coli Enterobacter cloacae Klebsiella pneumoniae Pseudomonas aeruginosa Haemophilus influenzae Bacteroides fragilis Polypeptides Proteins DNA RNA Amino acidsK Miloura Paul - Biology_Unit 4 Pc X Seplquatic volve Sel Ciline fcal th CareX : m cceaianment A web.kamihq.com/web/viewer.html?state=%7B"kds%3A%5B 1 jGujPYSxQlex4AFCn8zftVSgM5PIG%5D%2C*action"%3A'open%2C'userld %3A"1129860039 E Miloura Paul - Darw. 100% A Kami Uploads Miloura Paul - Biology_Unit_4_Post_QuizEnzym Student Version pdf Cells in the stomach produce pepsin, an enzyme, to help digest food. Pepsin works best at a pH of 2. Which of these graphs most likely shows what will happen to the activity of pepsin as the pH of the stomach is increased? 2. EFFECT OF pH ON PEPSIN ACTIVITY A. EFFECT OF pH B. ON PEPSIN ACTIVITY pH pH EFFECT OF pH EFFECT OF pH ON PEPSIN ACTIVITY C. ON PEPSIN ACTIVITY pH pH DELL 23 2$ & 4 7 Pepsin Activity Pepsin Activity 5 Pepsin Activity Pepsin Activity COTimes New... в I U A 12 三=▼三 4 6. 10. Be familiar with the differences between Gram-positive and Gram-negative bacteria. MacBook Pro lılıean.khpcontent.com/biology/page/ch23pretest?type question-list&page_type-6896389 D YouTube * Maps raprer 1 Ablgall CAMERON- October 03, 2021 12:45:43 PM Return to Site 4. 56 1 3 9 10 11 12 13 14 15 16 17 (15 of 17) Match each group in the left column with the corresponding grouping in the right column. Marchantiophyta А. Non-vascular plants Lycopodiophyta В. Seedless vascular plants С. Pterdiophyta Non-vascular plants D. Seedless vascular plants Bryophyta E. Non-vascular plants Anthocerophyta Note: Clicking any button other than the Save Answer button will NOT save any changes to your answers! Save Answer Skip Question I Am Finished/Submit for Gradees/_518299_1/cl/outline?customClassicLocation =%2Fwebapps%2FBb-McGraw Hill-BB5744b9beb8ccb%2Fapp%2Flink%2Finbou Edits will not be automatically saved. Save now File Edit Format Tools Help Chapter 7 List Paragra... functions? ● Unsaved ● ● Calibri ● What types of nutrients do microbes require, and where are they obtained? What are the different nutritional types, and where do they obtain their carbon and energy? What are the various types of passive and active transport, and how do they work? How do various environmental factors affect microbes, and how are they classified based on these factors? T 11 Y BIU A - A What are the five ecological associations between microbes, and how do they work? How do microbes grow and divide, and what are the stages of a population growth curve? Chapter 8 What is metabolism, and what are the two general types of metabolic reactions? 0 Mar 12 111 !!! 8:08 A OSEE MORE QUESTIONS
