Urgently needed 27. With today's automated DNA sequencing methods, the products of the DNA sequencing reactions do not have to beseparated into four separate lanes of a DNA sequencing gel. What technical advancement allowed this change?Figures are reminders - they are not essential parts of the question.OT COGT ACCOGATCOTOTA4 lanes from a sequencing gelAutomated sequencing outputA) The development of double stranded DNA oligonucleotide primers that can be used to initiate DNA polymerizationfrom a specific site on the template DNA.B) The development of single stranded DNA oligonucleotide primers that can be used to initiate DNA polymerizationfrom a specific site on the template DNA.C) The development of colored dyes linked to the different dideoxynucleotides.D) The development of colored dyes linked to the different deoxynucleotides.E) None of the above

The correct answer to the question regarding the technical advancement that allowed the products of…

Answered: 27. With today's automated DNA…

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

1) What happened to the DNA at the different temperatures? How does Polymerase Chain Reaction exploit this property of DNA (Word count: 200) 2) Briefly outline the steps of DNA extraction as carried out in a lab for the purposes of sequencing, with reference to a published protocol from a company that supplies regents and kits for DNA extraction (e.g Qiagen, ThermoFischer, Invitrogen, or similar). Please Include the weblink for the published protocol you used as a reference
In a typical microbiology laboratory, reasons for no bands from a gel of a polymerase chain reaction may bedue to errors relating to omission of ingredients in the reaction mix and absence of the target sequence inthe template DNA. Based on (i) primer problem and (ii) purity/potential contamination of the target sequence, explain the reason for non-appereance on bands.
6 A. ( A bacterial plasmid is 100 kb in length. The plasmid DNA was digested to EcoRI + HaeIII (double digest). The fragments were then separated with electrophoresis, compleuon with two restriction enzymes in three separate treatments: EcoRI, HaeIII, and as shown EcoRI RESULTS OF GEL ELECTROPHORESIS EcoRI + Molecular Weight HaeIII Standards HaeIII Kilobase Pairs 100 90 80 70 60 Tlo 50 40 30 20 10 busu2 gaibo 2mbplom 00 ..AAATAT.... 'E Using the circle provided, construct a labeled diagram of the restriction map of the plasmid. Explain how you developed your map. dins29 ( (9.
1) Briefly outline the steps of DNA extraction as carried out in a lab for the purposes of sequencing, with reference to a published protocol from a company that supplies regents and kits for DNA extraction (e.g Qiagen, ThermoFischer, Invitrogen, or similar). Please Include the weblink for the published protocol you used as a reference. (Word limits: 300) 2) Why was there a greater A260 absorbance reading for your DNA sample that was incubated at higher temperatures. (Word Limits: 100)
1. Discuss why it is critical to add TE Buffer as the final solution to isolate the concentrated DNA. 2. Using a centrifuge, explain the rationale for separating various cellular components 3. What is the relevance of DNA being frequently referred to as the "blueprint for life?"
3a)ClustalX software was used to perform multiple sequence alignment of thefollowing five Nco protein sequences designated as Nco1-Nco5 (the provided figure). A pair of degenerate primers was designed to PCR-amplify a DNA segment with the size of approximately 290 bp. With justification, discuss which amino acidsequence blocks would be suitable to design the forward and reverse degenerate primers.
DNA Polymerase Holoenzyme IIlI is represented below. It consists of several domains with distinct functions. The structure capable of 5' to 3' DNA polymerization is represented by the letter and the structure capable of 3' to 5' exonuclease activity is represented by the letter B. -D DNA Pol II holoenzyme D; A А; С А;B А А; D В; D O O
25. The restriction enzymes Kpnl and Acc651 recognize and cleave the same 6-bp sequence. You have a plasmid and a linear DNA strand that both contain a Kpnl and Acc651 sequence in the same orientation as shown below. You digest both DNA pieces with both enzymes and then attempt to ligate the sticky ends, followed by treatment with DNA ligase. What will happen? 5' GGTACC3' 5' G G T ACC 3' 3' CCATGG 5' y CCATGGS Kpnl Acс651 A) You will produce sticky ends but the two types of ends will not ligate. Instead, you may produce a small amount of religated plasmid where the digested plasmid sequence re-inserts. B) You will produce a recombinant plasmid in which the linear DNA strand is ligated in between the two sites, suitable for cloning. C) You will produce blunt ends that will not ligate because the two restriction enzymes will both operate on both of the sites. D) All the DNA will be completely digested as if you had applied a general DNAse enzyme.
4. Animation 12.4: This table shows results from a genetic test conducted on DNA samples from two patients. The patients are a newly married couple seeking genetic counseling about their risks of passing on a genetic disease to any children they may have in the future. The samples included the DNA region including and immediately surrounding a single gene. Restriction enzyme cleavage analyses were performed on the samples. Female Patient 1) 3400 bp fragment Male Patient 1) 1600 bp fragment 2) 1800 bp fragment 3) 3400 bp fragment DNA fragments on gel What do the genetic test results indicate about this case? O Both the woman and the man are homozygous for the mutation. O Both the woman and the man are heterozygous. O The woman is homozygous for the mutation and the man is homozygous for the normal gene. O The woman is homozygous for the mutation and the man is heterozygous.
1. Why do we need to check the isolated DNA for its quantity and quality? 2. The purity of DNA sample is below 1.8 A260/A280 so, where did the proteincontamination come from? Note: Cite the in-text citation and references
1) The DNA fragment shown in Figure 1 is cleaved by the restriction enzyme EcoRI as indicated. The number in parenthesis shows the position of the cleavage site. The total length of the DNA fragment is 4000 bp. Small parts of the DNA sequence is known as shown. 5' ACCCTAGGTGTGACCGCGATCCGGCAGCATAAT 3' EcoRI (400) EcoRI (1300) EcoRI (3800) 3' CGCGAAATGCTTTAAGCGCTCTACGGGAGGG5' 3'AGCGTTAGAGTAGCCGGTAAAGGGTACGCGCCTTAA 5' Figure 1: DNA fragment with a total length of 4000 bp. The figure below depicts a gel on which marker DNA of known size has been run. Sketch the location of the bands that will appear, if the DNA fragment shown in Figure 1 is cleaved by EcoRI and afterwards run on the gel along with the marker DNA. 6000 5000 4000 3000 2000 1000 800 600 500 400 200
I. You wish to perform an electrophoretic resolution of your restriction enzyme–digested DNA. The sizes of the expected fragments range from 100 to 500 bp. You discover two agarose gels polymerizing on the bench. One is 0.5% agarose; the other is 2% agarose. Which one might you use to resolve your fragments? I. What does it mean to “denature” a protein and why is this important for SDS PAGE? II. Describe how you denatured the proteins you used for SDS-PAGE. III. Describe the roles of the primary Antibody and the secondary Antibody during an ELISA test. IV. After the addition of the secondary Antibody, how did you determine which wells contain the Antigen bound to primary Antibody bound to secondary Antibody?

SEE MORE QUESTIONS

Recommended textbooks for you

Human Anatomy & Physiology (11th Edition)

Biology

ISBN:

9780134580999

Author:

Elaine N. Marieb, Katja N. Hoehn

Publisher:

PEARSON

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Anatomy & Physiology

Biology

ISBN:

9781259398629

Author:

McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter

Publisher:

Mcgraw Hill Education,

Human Anatomy & Physiology (11th Edition)

Biology

ISBN:

9780134580999

Author:

Elaine N. Marieb, Katja N. Hoehn

Publisher:

PEARSON

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Anatomy & Physiology

Biology

ISBN:

9781259398629

Author:

McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter

Publisher:

Mcgraw Hill Education,

Molecular Biology of the Cell (Sixth Edition)

Biology

ISBN:

9780815344322

Author:

Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter

Publisher:

W. W. Norton & Company

Laboratory Manual For Human Anatomy & Physiology

Biology

ISBN:

9781260159363

Author:

Martin, Terry R., Prentice-craver, Cynthia

Publisher:

McGraw-Hill Publishing Co.

Inquiry Into Life (16th Edition)

Biology

ISBN:

9781260231700

Author:

Sylvia S. Mader, Michael Windelspecht

Publisher:

McGraw Hill Education

SEE MORE TEXTBOOKS