2. Below are sequence fragments for a segment of Drosophila Chromosome 3, generated by shotgun sequencing of the genome. Align them into the longest possible contig. a. GACTTTCCGAAAGTGCACAG b. AAGTGCACAGATTTTCGGATGC GAGCATCACATCTTGAAGACGC c. d. TTTTCGGATGCGCAAAAGAG e. CCGAAAGTGCACAGATTTTCGGA f. GATGCGCAAAAGAGCATCACATCTTG

2. Below are sequence fragments for a segment of Drosophila Chromosome 3, generated by shotgun sequencing of the genome. Align them into the longest possible contig. a. GACTTTCCGAAAGTGCACAG b. AAGTGCACAGATTTTCGGATGC GAGCATCACATCTTGAAGACGC c. d. TTTTCGGATGCGCAAAAGAG e. CCGAAAGTGCACAGATTTTCGGA f. GATGCGCAAAAGAGCATCACATCTTG

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 8TYK

See similar textbooks

Similar questions

12. a. You want to create a genetic construct that will express GFP in Drosophila. In addition to the GFPcoding sequence, what DNA element(s) must youinclude in order to express this protein in flies if theconstruct were integrated into the Drosophila genome? Where should such DNA element(s) be located? How would you ensure that GFP is expressedonly in certain tissues of the fly, such as the wing?b. Suppose you insert the GFP coding region plus allof the DNA elements required by the answer to part(a)—except the enhancer—between inverted repeatsfound at the ends of a particular transposable element.Because all of the DNA sequences located betweenthese inverted repeats can move from place to placein the Drosophila genome, you can generate manydifferent fly strains, each with the construct integrated at a different genomic location. You now examine animals from each strain for GFPfluorescence. Animals from different strains showdifferent patterns: some glow green in the eyes,others in…
A. Deletion of the SOX9 gene leads to sex reversal resulting in a person with karyotype 46XY being phenotypically Explain the genetic basis for this. B. Describe what would happen to the phenotype of a male with a mutation in the gene encoding SF1? Explain your answer.
Q1. (Shown below is the structure of a Drosophila gene, divided into 10 segments, designated A-J. The gene contains three exons, two introns, a promoter, and a site in I for poly(A) addition. Exon 1 Exon 2 Exon 3 Promoter Intron 1 Intron 2 AATAA A в CDE FG|H a) What segment or segments of the gene will be represented in the initial RNA transcript (primary RNA)? List the appropriate letter or letters. b) What segment or segments of the gene will be found in the completely processed transcript (mature RNA)? c) What segment or segments of the gene in the processed transcript will have additional nucleotides added to them? d) If the segment... . is methylated, this could block the transcription's initiation as RNA polymerase will not be able to bind to this segment.
2. a. You want to create a genetic construct that will express GFP in Drosophila. In addition to the GFPcoding sequence, what DNA element(s) must youinclude in order to express this protein in flies if theconstruct were integrated into the Drosophila genome? Where should such DNA element(s) be located? How would you ensure that GFP is expressedonly in certain tissues of the fly, such as the wing?b. Suppose you insert the GFP coding region plus allof the DNA elements required by the answer to part(a)—except the enhancer—between inverted repeatsfound at the ends of a particular transposable element.Because all of the DNA sequences located betweenthese inverted repeats can move from place to placein the Drosophila genome, you can generate manydifferent fly strains, each with the construct integrated at a different genomic location. You now examine animals from each strain for GFPfluorescence. Animals from different strains showdifferent patterns: some glow green in the eyes,others in…
8. Below is a diagram of the MYC gene, match the arrows with the correct description. 127.73M Genes (Comprehensive set... MYC-201 protein coding - MYC-209 protein coding DO MYC-203> protein coding 0- protein coding 2 - MYC-208> protein coding O MYC-202 protein coding O MYC-205> protein coding MYC-207> protein coding D 0 MYC-204 processed transcript 1 MYC-211> protein coding ← MYC-206> protein coding 2 i. Arrow 1 is pointing at ii. Arrow 2 is pointing at A. polyadenylation site B. 3' untranslated region C. transcription start site D. intron -27-52 kb 127.74M - MYC-212 > arotein codina E. 5' untranslated region F. promoter region G. transcription stop site H. protein coding region 127.73
1. Below are the DNA sequences that encode the first eight amino acids for five alleles of the Adh protein in Drosophila pseudoobscura. Nucleotides that differ from the first sequence are shown by a lowercase letter. ATGTCTCTCACCAACAAGAACGTCATGgCTCTCACCAACAAGAACGTCATGTCgCTCACCAACAAGAACGTCATGTCTtTgACCAACAAGAACGTCATGTCTCTCACCAACAAGAACGTg a) What are the first eight amino acids for each of these five DNA sequences?
1. Assume that figure (A) represents a normal karyotype of this animal. What is the diploid number of thisanimal? 2.Cell (A) contains 3.1 billion (3.1 x 109) base pairs of DNA. Each nucleosome has about 200 bp of DNAwrapped around the histone core.a. What is the maximum number of nucleosomes that can be present in the cell?b. What is the maximum number of H2A histone protein molecules that can be present in the cell?
For the first experiment ever on Drosophila mutations. Answer the following questions. a. What is the title of the first published paper explained the experiment and what is the name of the Author? b. What is the first mutation discovered in Drosophila? c. Explain the changes in the Drosophila yellow mutant (Y)compared to wild type.
Please type your answer 1A. What is the molecular basis for genomic imprinting? B. How is the process of X-chromosome inactivation similar to genomic imprinting. C. How is the process of X-chromosome inactivation different from genomic imprinting. D. In mice, the Igf2 gene inherited from the mother is never expressed in her offspring? Explain. E. What genes are deleted in a female born with Angelman syndrome. Which parent transmitted the deletion to her?
1.What percentage of DNA do Humans share with Drosophila melanogaster? Please give detailed information of the D. melanogaster genome. (We are expecting to have exact numbers).
1. Is the Homo sapiens phenylalanine hydroxylase (PAH) gene encoding a non-coding protein or an enzyme? What function does this protein serve? If necessary, you may include a mechanism. 2. What function does this gene perform? It is located on what chromosome number?
19. The diagram below represents a process that occurs during sexual reproduction. A B C + - (Not drawn to scale) The process represented by the arrow will ensure that *REQUIR structures A and B contain a complete set of genetic information structure C contains half of the genetic information structures A and B contain half of the genetic information structure C contains a complete set of genetic information *REQUIRED