1)Which of these molecules is responsible for bringing the correct amino acid to the ribosome? RNA polymerase DNA None of these tRNA rRNA acetyl transferase mRNA
Q: Which of the following segments of RNA are retained after conversion of a pre-mRNA to a mature mRNA?…
A: RNA: it is of different types such as rRNA, tRNA, mRNA etc.
Q: Which mRNA strand is complementary to this template DNA strand: 5’-CTGCAT-3’? 3’-AUGCAG-5’…
A: Template strand is the strand of DNA molecule on which the mRNA is synthesized. Complementary strand…
Q: The RNA complement of a protein coding gene is what? A) mRNA B) rRNA C) snRNA D) tRNA
A: Explanation: The mRNA specifies, in triplet code, the amino acid sequence of proteins
Q: What genetic material in a living cell which is single stranded involved in the coding of genes for…
A: The flow of information in cells takes place from transcription to translation. The translation is…
Q: Consider this list (below) of steps involved in translation. These steps are out of order.…
A: Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum generate…
Q: All of the following participate in the process of translation except: ribosomes mRNA tRNA 35S…
A: Translation It is defined as the process of production of proteins from the mRNA transcript. In…
Q: Which of the following is the function of transfer RNA? a.Makes up the structure of ribosomes…
A: The central dogma states that the DNA is transcripted into RNA which is translated into proteins.…
Q: Which of the following statements about the spliceosome is false? a. A spliceosome splices pre-mRNA…
A: For RNA maturation there are about 40 different types of proteins and small RNAs that are called sn…
Q: Process of translation True False transfer RNA is made from messenger RNA participation of rRNA…
A: Deoxyribonucleic acid (DNA) is the biomolecule that contains genetic information necessary for all…
Q: which of the following is mismatched a- small RNA catalyic with or without proteins b- rRNA 80% of…
A: RNA is coded from DNA with the help of RNA polymerase enzyme; the process of RNA synthesis is called…
Q: Which of the following is always true of ribosomes? The small ribosomal subunit is composed of only…
A: Ribosomes are macromolecular machines that perform biological protein synthesis and are found in all…
Q: DNA Leading strand: 5' AAA ATA | CGC TTT| TTA ATT | AAC CCC GGG 3' A I B |C| D Exons: A, C, D…
A: The process of synthesizing RNA from the genetic information encoded by DNA is called Transcription…
Q: What are ribosomes composed of? tRNA & proteins mRNA & tRNA rRNA & proteins mRNA & proteins…
A: The ribosomes are composed of two subunits a smaller and a larger and the sizes of prokaryotic and…
Q: Which part of the ribosome in bacteria, forms the catalytic site for peptide bond formation? A. 16S…
A: Ribosomes are small particles in cytoplasm associated with ER membrane. Ribosome is made up of…
Q: Which of the following is the function of transfer RNA? A. Carries the message that guides…
A: Ribonucleic acid (RNA) are polymeric organic molecules, which are essential for carrying out various…
Q: Which nucleic acid has a double helix structure? tRNA mRNA rRNA DNA
A: Nucleic acids that are present in the environment can be of two different types based on the type of…
Q: Process of translation *( Choose True if the statement is correct about Process of translation and…
A: DNA or deoxyribonucleic acid is a type of nucleic acid present in the nucleus of the cell. It is the…
Q: The sequence A is read by RNA polymerase to produce an mRNA that is translated by the ribosome:…
A:
Q: It is a large complex ribonucleoprotein particle that chemically modifies the pre mRNA strand by the…
A: A ribonucleoprotein (RNP) is a complex of ribonucleic acid and RNA-binding protein.
Q: Shown below is the 5' end of an mRNA molecule. What are the first three (N-terminal) amino acids of…
A: Through transcription the DNA molecule is converted into mRNA.
Q: 3’-T A C G G A C T G A C G A T C-5’ What is its Complementary DNA sequence? mRNA sequence…
A: The term mutation refers to the change of DNA sequence which occurs either due to errors in DNA…
Q: Which of the following is the first step of translation in a eukaryotic cell? a RNA containing…
A: Translation is the process of protein synthesis which is done by ribosomes.
Q: Build the mRNA molecule matching the RNA nucleotides to the DNA nucleotides properly letter by…
A:
Q: True or False Process of translation 1. transfer RNA is made from messenger RNA 2. tRNA uses…
A: Translation: The process of translation involves the synthesis of a protein or a polypeptide inside…
Q: Ribosomes are the structures that translate mRNA sequences into amino acid sequences (i.e.,…
A: Ribosomes are the main structure where protein or polypeptide is made.
Q: A strand of DNA, TACGCT, serves as a template for mRNA transcription. What would be the correct…
A:
Q: Which of the following RNA molecules is responsible for carrying the code that will be read at the…
A: Proteins ar polymers of amino acids. Major functions embrace acting as enzymes, receptors, transport…
Q: Which enzyme is responsible for the synthesis of pre-mRNA? A. RNA polymerase I B. RNA…
A: Correct option is B.RNA polymerase II The nucleus uses the nucleotide sequence of DNA as a template…
Q: If you were to hybridize a eukaryotic gene to its corresponding mRNA, the two molecules would not…
A: The transcription is the process in which the mRNA copied information from DNA for protein…
Q: Antibiotics that selectively inhibit bacterial growth exploit differences between bacterial and…
A: Antibiotic action that selectively functions on inhibition of cellular activities of the bacterial…
Q: What mRNA base sequences are complementary to the following DNA template sequences? Be sure to label…
A: The process by which the mRNA is transcribed from the parental DNA is known as the process of…
Q: RNA polymerase will attach with what sequence(s) and begin to make RNA? Anticodon Promotor stop…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: What is the sequence of the MRNA codon that binds to the anticodon 3'-AAG-5'? 5'-AAG-3' 5'-TTC-3'…
A: Anticodon: A trinucleotide sequence that is complementary to a matching codon in a messenger RNA…
Q: A single RNA molecule with many gene sequences… a. is only found in eukaryotes b. is not…
A: Single RNA molecule with many gene sequences is called a Polycistronic RNA and is found in many…
Q: When the ribosome reaches a nonsense codon, which of the following occurs? a methionine is…
A: Ribosomes are translational machinery utilized during the synthesis of proteins. It is a complex of…
Q: tRNAs carry amino acids bind to the anticodon present in the mRNA adapt the genetic information to…
A: Transfer ribonucleic acid (tRNA) is a type of RNA molecule that helps decode a messenger RNA (mRNA)…
Q: Process of translation *( Choose True if the statement is correct abourt genetic code and False if…
A: Translation is the process of translating the sequence of a messenger RNA (mRNA) molecule to a…
Q: Which of the following is responsible for creating the covalent bonds that link the amino acids of a…
A: RNA stands for ribonucleic acid which plays a key role in the metabolic processes for all steps of…
Q: All of the following are true regarding mRNA processing except: O a. It occurs in the cytoplasm of…
A: The central dogma represents the flow of genetic information from DNA to RNA to protein. DNA…
Q: The anticodon … A. is complementary to the mRNA B. is found on the ribosome C. is found…
A:
Q: Which of the following is true about the three major classes of RNAs in the cell: mRNAs, tRNAs, and…
A: Ribonucleic acid abbreviated as RNA, is nucleic acid found in living cells share the same structural…
Q: what is the first event to take place in translation in eukaryotic cell? a. An clongation of the…
A: Translation is the process which is responsible for synthesis of protein from the mRNA.
Q: Here is a DNA template strand’s sequence and direction: 3’-TACGCGGTAATC-5’ . What is the sequence…
A: The deoxyribonucleic acid (DNA) undergoes the process of transcription for synthesizing the…
Q: The role of transfer RNA (tRNA) is to match a codon (3 bases) in mRNA sequence to: A. An amino…
A: The process of protein synthesis is also known as translation. It is possible with the help of…
Q: A DNA template strand having the sequence shown below would produce an mRNA molecule with that with…
A: DNA gets transcribed into mRNA by using RNA polymerase enzyme. mRNA is single stranded and DNA is…
Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…
A: DNA consists of two intertwined polynucleotide strands: coding strand and template strand. The…
Q: For each amino acid added to a polypeptide which of the following must happen? a a charged tRNA…
A: Option (d) is correct.
Q: codon
A: The number of codon binding sites in an mRNA-ribosome complex that can be occupied at the same time…
Q: Which of the following is the complementary MRNA sequence to a DNA gene with the sequence 3'…
A: DNA is the basic unit of inheritance. DNA contains genes which are transcribed to messenger RNA and…
Q: Match each term with the most appropriate description. sites for polypeptide assembly binds to…
A: All cells have the translation process resides within a specialized organelle which is known as the…
1)Which of these molecules is responsible for bringing the correct amino acid to the ribosome?
RNA polymerase
DNA
None of these
tRNA
rRNA
acetyl transferase
mRNA
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- The binding specificity of σ subunit of RNA polymerase is dependent on DNA sequence.What does it define- defining theprocess of transcription- DNA to RNA The code is nonoverlappingRNA codon table 2nd position A 1st U 3rd position position U Phe Phe Leu Leu Leu Leu C Leu Leu Ser Ser Ser Ser Cys Сys stop Тyr Тyr U stop Trp stop Pro Pro Pro Pro His His Gln Gln Arg Arg Arg Arg lle lle lle Met Thr Thr Thr Thr Asn Asn Lys Lýs Ser Ser Arg Arg Gly Glý Glý Glý A Val Ala Ala Ala Ala Asp Asp Glu Glu Val G Val Val Amino Acids Ala: Alanine Arg: Arginine Asn: Asparagine Asp:Aspartic acid Cys:Cysteine Gin: Glutamine Glu: Glutamic acid Lys: Lysine Gly: Glycine His: Histidine le: Isoleucine Ser: Serine Thr: Threonine Trp: Tryptophane Leu: Leucine Met: Methionine Phe: Phenylalanine Tyr: Tyrosisne Pro: Proline Val: Valine This figure shows the for translating each genetic codon in into an Four "special" codons are the codon: AUG ant the three codons: UAA, UAG, and UGA. The specification of a single amino acid by multiple similar codons is called believed to be a cellular mechanism to the negative impact of random TRUE or FALSE : Each species uses its own genetic code for protein…
- Which of the triplets below is a possible anticodon for a tRNA that transports Leucine (Leu) to a ribosome? Second letter C UGU cys UCU1 UCC UCA UCG UAU Tyr UACS Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUU UGCS Phe UUC U UUA UUG FLeu CAU HiS CGU] CUU CUC Leu CCU ССС CCA CCGJ CACS CGC Arg CGA CAA GIn Pro C CUA CUG J CAG S CGG AUU AUC lle AUA AAU Asn AGU ser ACU АСС Thr ACA AAC AAA ys AGA Arg AAG J AGC AUG Met ACG Lys AGG J GUU GUC CUA Val GAU ASP GCU GACJ GCC FAla GGU] GGC CGA Gly CCA C CAA M UCAG Third letter UCAG UCAG First letterRNA polymerase in Escherichia coli normally synthesizes all of the following molecules except: RNA primers during DNA replication messenger RNA (mRNA) transfer RNA (tRNA) ribosomal RNA (rRNA) heterogenous nuclear RNA (hnRNA)AGUCAGUCAG The codon chart is shown below, what amino acid sequence does the MRNA sequence: 3' UUUCCUCAA 5' code for? RNA Codon Chart 31 Alanine G U A Tyrosine Stop Valine A G Cysteine U 3' U G Stop G Tryptophan 3' G 5' Arginine G U A Leucine Serine A Lysine A U Proline G Asparagine leucine-threonine-glutamic acid asparagine-serine-phenylalanine serine-histidine-glutamine phenylalanine-proline-histidine phenylalanine-proline-glutamine Serine Glutamic acid Aspartic acid Histidine Glutamine Arginine Isoleucine 2 Threonine Methionine Q
- 3’-TCTTCGTGAGATGATATAAGAGTTATCCAGGTACCGGTAAACTGG-5’ 5’-AGAAGCACTCTACTATATTCTCAATAGGTCCATGGCCATTTGACC-3’ Write down the mRNA transcript from DNA above.The transcriptional complement of the DNA strand with the code 3’ TAA-CAT-GCT 5’ isMatch the ribosome antibiotics with their binding sites and activities Puromycin [ Choose ] Macrolides (azithromycin, i.e., Z-pak) [ Choose ] Aminoglycosides (kanamycin) [ Choose ] Chloramphenicol V[Choose ] Binds the 30S subunit at the decoding site, interferes with decoding, leading to mis-reading andproduction Binds the E site and prevents de-acylated tRNAs from exiting. This drives pt'ase activity backwards and Binds the A site and mimics an aa-TRNA, is added onto the growing peptide chain by the pt'ase activity of Binds the peptidyltransferase site and blocks pt'ase activity, may also block the TRNAS from entering the A
- Give the single letter translation for the protein encoded by this mRNA. Start with the start codon. 5' M7GPPP- CCGACGUAUAUGGCGACUGAUCACUGACCAACGAAAA O ATDHXPTK OPTYMATDH MRAHVT O MATDH AAAAAA - 3'Translate the mRNA sequence of HBs mRNA 5'- AUG GUG CAC CUG ACU CCU GUG GAG AAG UCU GCC GUU ACU -3'otein structure urs Chaperones AUG Zwitterion Tarm Aminoacyl-tRNA synthetase Unanswered 0 0/1 answered III I III A compound with no electrical charge made up of separate molecules with positive and negative charges that balance each other out. Attaches the appropriate amino acid to a tRNA molecule based on its anticodon. Surprisingly contains a thymine in it despite being a piece of RNA. Recognized by the anticodon UAC. Small group of proteins that assist protein folding. Submit