16. If the aerobic catabolism of 1 mol of glucose yields 38 mol of ATP, and the energy released by aerobic ATP hydrolysis to ADP is -46 kJ/mol, how much energy is available from 1 mol of glucose via aerobic catabolism?
Q: In Biochemistry,What is the main characteristic of peptide bond?what does it means by partial double…
A: Introduction Amino acids are the building blocks of proteins. Proteins is the most abundant…
Q: 1. What is the effect of boiling in the test tube with starch solution and saliva?
A: Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: One advantage of the protein structures solved by NMR comparing to the x-ray structures is: a. It…
A: Proteins are composed of amino acids attached together via peptide bonds. There are twenty standard…
Q: Which of these are components of animal fatty acid synthase (FAS)? B-ketoacyl reductase enoyl…
A: The majority of healthy human tissues primarily create new structural lipids from circulating…
Q: The glycerol phosphate shuttle moves reducing equivalents (electrons) from the cytosol to the…
A: Shuttle systems are the systems which help in the transport of electrons from NADH present in the…
Q: 31. Margarine is made from vegetable oil by a chemical process. Do you suppose this process converts…
A: Margarine is a product derived from vegetable oil, obtained by the hydrogenation,…
Q: Identify the type of glycosidic linkage present in the disaccharide below: O a (1-6) O a (1-4) 03(1…
A: Disaccharides are oligosaccharides composed of two monosaccharide units. The monosaccharide units in…
Q: Detergents disrupt hydrophobic interactions by coating hydrophobic molecules with molecules that…
A: Hemoglobin is an oligomeric protein with four polypeptides. The individual polypeptides are joined…
Q: If we were handed a tube of 2mg/mL BSA how much is required 20μL of each of the following…
A: Different concentrations of protein solutions are needed to be prepared during biochemical…
Q: 1a. Whats the difference between continuous and discontinuous synthesis? 1b. Why replication…
A: According to the semiconservative model of DNA replication proposed by Meselson and Stahl, each…
Q: The active site _______________. a. is the compound that an enzyme reacts with during the chemical…
A: The active site is that region of an enzyme where substrate molecules bind. The binding of substrate…
Q: how would you prepare a 3-fold dilution series
A: Serial dilution : A substance is diluted in a solution step by step in a serial dilution procedure.…
Q: 7. To what volume must 30 mL of a 2.5M NaOH solution be diluted to make a 0.4M solution?
A: Molarity is way of representing the concentration of a solution. Molarity is number of moles of…
Q: What is the principle involved in mucic acid test?
A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified into monosaccharides,…
Q: An allosterically regulated enzyme in the R state is unable to bind substrate at the active site.…
A: Allosteric site : It is a place or site on an enzyme where the molecule which is not a substrate can…
Q: Which of the following statements about alpha-helix and beta-sheet structure are true? More than one…
A: A protein's function depends on its structure. There are four levels of protein structure: primary,…
Q: Glycolisis is process that is reversible, meaning that any product that is being formed can easily…
A: During the catabolism of amino acids, for it to be used as a respiratory substrate, first the alpha…
Q: The octapeptide gly-cys-met-asn-lys-ala-tyr-gly was hydrolyzed consecutively by CNBr and then…
A: The octapeptide gly-cys-met-asn-lys-ala-tyr-gly was hydrolyzed consecutively by CNBr and then…
Q: Propose a pathway for the following compound to enter gluconeogenesis / glycolysis. In your pathway,…
A: The compound given is not a common biomolecule or metabolite. It is methanolglyoxal , the alcoholic…
Q: What volume of a 0.8 M glucose solution can be made from 50 mL of a 2M stock solution?
A: Stock solution is the given solution present in lab. From the stock solution, we make the working…
Q: Now use the equations above and the empirical values below to calculate VO₂ (the rate of oxygen…
A:
Q: Give at least 5 sources of protein.
A: Protein is a biomacromolecule formed by repeating units of amino acids. They are the building blocks…
Q: A culture of E. coli growing in a medium containing the normal, lighter isotope of nitrogen (14N) as…
A: Recall that: An important characteristic of DNA replication is that it is semiconservative. Two…
Q: -Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the…
A: Note: Hi! Thank you for the question. We are authorized to answer three subparts at a time. Since…
Q: Why can you not create a Ramachandran plot for RNA molecules? Is it possible to get a similar type…
A: Ramachandran plot is plot that describes the distribution of torsional angles called phi and psi ,…
Q: 1. Why are eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) important? 2. What are the…
A: Lipids are compounds that are soluble in organic solvents and insoluble in polar solvents such as…
Q: Figure 4.16 - Structure of the Heme Group N H Pyrrole OOC H₂C H₂C H₂C H₂CC HC C-C H = C HgC C NH N 1…
A: These images correspond to the structure or components of heme, an integral part of hemoglobin…
Q: Calculate the net charge on the following tripeptides at pH 5.0: (a) Leu-His-Asp [0] (b)…
A: Recall that: Amino acid sequences are written with N-terminal amino acid on the left and C-terminal…
Q: Draw: Amino-terminus on the left, Carboxy-terminus on the right L-Ala (aka S-alanine) D-Ala (aka…
A: Alanine is an amino acid with molecular formula C3H7NO2. It has a methyl group as side chain.…
Q: Draw the Gluconeogenesis pathway (pyruvate to glucose) and identify at most 5 different organic…
A: Gluconeogenesis is a metabolic pathway in which glucose is synthesized from certain non-carbohydrate…
Q: Because of the helix dipole, the phosphate ions are likely to bind to a. The side-chains of…
A: Function of a protein depends on it's three dimensional structure and structure of the protein can…
Q: a) Draw a non-covalent interaction between a water molecule and the charge on a phosphorylated…
A: Unlike covalent interactions where there is sharing of electrons between two atoms, in non-covalent…
Q: . The importance of recombinant DNA technology in pharmaceutical industry b. Potential products…
A: Recombinant DNA technology is an important tool as it allows for the manipulation of DNA fragments…
Q: will UPVOTE Kindly answer the question. 1. Do you think free amino acids will give a positive…
A: Proteins are responsible for most of the functional and structural capabilities of cells. Proteins…
Q: Using an arrow, draw the site of cleavage for the following peptide that is reacted by: Pepsin…
A: Any peptide or protein can be cleaved by numerous protein digestive enzymes such as pepsin, trypsin,…
Q: What charged groups are present in glutamate at a pH = 7? OA) 1× NH3+ B) 1 x COOT C) 1× NH3 and 1 x…
A: Glutamate is an amino acid with molecular formula C5H9NO4. It is considered as acidic amino acid due…
Q: Propose a pathway for the following compound to enter gluconeogenesis / glycolysis. In your pathway,…
A: Glycolysis is a collection of 10 enzymatically catalysed reactions that sequentially oxidise a…
Q: Please answer fast draw pyruvate carboxylase mechanism. cofsctors must include. label all…
A: Pyruvate carboxylase is an enzyme which catalyzes the conversion of pyruvate to carboxylase.…
Q: Describe the process of denaturation of protein.
A: The proteins are most active in their native structure. Native conformation of the protein is the…
Q: For the tetrapeptide KASE: a. Draw its complete protonic equilibria. Indicate the net charge of each…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: A pentapeptide has a titration curve that shows five inflection points for five equivalents of…
A: Amino acids contain ionizable groups. The ionic form of the amino acids depends upon the pH of the…
Q: How does ATP releases the energy used by the Cell/What happens to ATP for the energy release/what…
A: ATP is also known as adenosine triphosphate. ATP is also called the energy currency of the cell. ATP…
Q: The brown discoloration of apples and potatoes is due to an enzyme catalyzed chemical reaction.…
A: Cut apples and potatoes turn brown or discolored on exposure to air. This is due to conversion of a…
Q: A dialysis tube that contains 10 mL of a 5% sucrose solution and that is permeable to water but not…
A: It is the movement of water from higher water concentration to lower water concentration through a…
Q: At a pH of 10, would you expect this peptide to be retained for a longer time within an anion…
A: Ion exchange chromatography separates molecules based on their charge difference. A cation exchange…
Q: The graph is an example of the rate of product production by an enzyme when the substrate is in…
A: An enzyme has substrate binding site. When substrate binds to that site, the reaction takes place.…
Q: Which of the amino acids does NOT have an aliphatic side chain? a. Lysine b. Alanine…
A: R groups in aliphatics are nonpolar and hydrophobic. The hydrocarbon chain's hydrophobicity rises as…
Q: Identify basic structure of the 8 types of membrane proteins shown below Understand how primary…
A: According to the fluid mosaic model of the plasma membrane is a phospholipid bilayer that has…
Q: You've discovered a novel biosynthetic pathway that makes the molecule caffeine. The pathway can be…
A: In biochemistry, a metabolic pathway is series of enzyme catalysed reaction where product of one…
Q: Assumed that you have isolated the protein cytochrome C from a cell lysate. Discuss the advantages…
A: Cytochrome C Cytochrome C is a protein that is loosely bound to the inner membrane of mitochondria…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- 1. Assuming that everything that’s needed to make tripalmitin comes from glucose, how many glucose would be used by adipose tissue in the synthesis of 1 mol tripalmitin? 2. How many ATP would be used (net of produced and used)? 3. If an animal absorbs 35 g glucose (MW = 180 g/mol) from drinking a can of pop, how many grams of tripalmitin (MW = 807 g/mol) can be produced from it in adipose tissue? Please provide only typed answer solution no handwritten solution needed allowed10. The reaction for cellular respiration is exergonic (AG = -2870 kcal/mol) but only produces 32 ATP per molecule of glucose, representing an energy total of AG = +976 kcal/mol. What can explain this discrepancy? A. One molecule of glucose produces 2 pyruvate during glycolysis and cellular respiration therefore produces a total of 64 ATP. This makes up for the difference in energy converted from glucose to ATP. B. Both NADH and FADH₂ are also produced and contribute to some ATP, on top of the 32 ATP already produced. C. Energy remains in some glucose molecules that are not yet oxidized. D. Energy is lost in the form of heat. E. Cellular respiration includes some endergonic reactions that make up the difference in energy converted from glucose to ATP.Walking consumes approximately 100 kcal/mi. In the hydrolysis of ATP (ATP → ADP + Pi), the reaction that drives muscle contraction, ΔG°′ is −7.3 kcal/mol (−30.5 kJ/mol). Calculate how many grams of ATP must be produced to walk a mile. ATP synthesis is coupled to the oxidation of glucose (ΔG°′ = −686 kcal/mol). How many grams of glucose are actually metabolized to produce this amount of ATP? (Assume that only glucose oxidation is used to generate ATP and that 40% of the energy generated from this process is used to phosphorylate ADP. The gram molecular weight of glucose is 180 g and that of ATP is 507 g.)
- is this stement false? Intracellular concentrations in resting muscle are as follows: Fructose-6-phosphate (1.0 mM)Fructose-(1-6)-bisphosphate (10.0 mM)AMP (0.1 mM)ADP (0.5 mM)ATP (5.0 mM)Pi (10.0 mM)Under the above conditions the Phosphofructokinase reaction in muscle is more exergonic than under standard conditions.23. An important step in glycolysis is the formation of ATP and pyruvate from phosphoenol-pyruvate (PEP) and ADP. PEP ADP pyruvate+ATP The equilibrium constant (Keq) for this reaction is approximately 2.5x10°. Calculate standard free energy change (AG°') for this reaction. Show your work. onege b. Is the reaction exergonic or endergonic at standard conditions? If, at equilibrium, the concentrations of ADP and ATP are 0.2 mM and 2.0 mM, respectively, what is the equilibrium concentration ratio of [pyruvate] to [PEP]? Show your work. с.24. Hexokinase catalyzes the phosphorylation of glucose from ATP, yielding glucose-6-P and ADP. The standard-state free energy change for hydrolysis of glucose-6-P is -13.9 kJ/mol. Calculate the standard-state free energy change and equilibrium constant for the hexokinase reaction. AG" for ATP hydrolysis -31.5 kJ/mol
- 19. Calculate the standard free-energy change of the reaction catalyzed by the enzyme phosphoglucomutase, given the equilibrium concentration of 1.0 mM glucose-1-phosphate and 19 mM glucose-6-phosphate at 25 C. Glucose-6-phosphate Glucose-1-phosphate21. Based upon the following reactions, what would be the AG" for the formation of ATP from phosphoenolpyruvate and ADP? ATP → ADP + Pi phosphoenolpyruvate pyruvate + Pi AG" = -31.5 kJ/mol AG"=-62.2 kJ/mol1. a) Calculate the approximate net yield of ATP during the aerobic conversion of 2 glycerol to 1 glucose. Show work
- The Standard Free Energy Change for the hydrolysis of ATP -->ADP + Pi = -30.5 kJ/mol. What is the Actual Free Energy Change for the hydrolysis of ATP in Rat Hepatocytes in kJ/mol? Rat Heptatocye ATP=3.38 ADP 1.32 AMP 0.29 Pi= 4.8 Group of answer choices -46.0 -29.9 -44.0 -19.6 -28.33. One indication of the relative importance of various ATP-producing pathways is the Vmax of certain enzymes of these pathways. The values of Vmax of several enzymes from the pectoral muscles (chest muscles used for flying) of pigeon and pheasant are listed below. Vmax (µmol substrate/min/g tissue) Enzyme Pigeon Pheasant Hexokinase 3.0 2.3 Glycogen phosphorylase Phosphofructokinase-1 Citrate synthase Triacylglycerol lipase 18.0 120.0 24.0 143.0 100.0 15.0 0.07 0.01 d. Why were these enzymes selected for comparison? Would the activities of triose phosphate isomerase and malate dehydrogenase be equally good bases for comparison? Explain.How much fat (in grams) would the body have to burn to produce the daily minimum requirement of 40 kg ATP from ADP and phosphate? Assume that: 1. The fat is metabolized completely to water and carbon dioxide. 2. The energy that is released can be used entirely for ATP production. 3. Complete oxidation of 1 g of fat to water and CO2 releases 9 kcal or 37 kJ. 4. The Delta G for ATP hydrolysis is -30.5 kJ/mol. You will have to look up one more value online to answer this question, but you do not need to know anything about lipid metabolism. A) approx. 16 to 17 g of fat B) approx. 65 to 66 g of fat C) approx 22 to 23 kg of fat D) approx. 267 to 268 g of fat E) approx. 5 to 6 kg of fat