1. What are the possible sources of error in the measurement of CK and LDH activity? 2. What is responsible for the false elevations of CK levels in hemolyzed samples?
Q: What are the major benefits and the disadvantages of a rumen system? How does a cecal animal compare…
A: Rumen system is the ruminant digestive system. Ruminants are those who eat plants- herbivorous…
Q: Select one specific compound representing a larger metabolite group (e.g. menthol for terpenes),…
A: There are several primary and secondary metabolite secreted from the plant as defense compounds. One…
Q: ? O A. Cornea OB. Iris OC. Pupil
A: This structure / diagram is that of an eye. Eye have various components. Question has asked the…
Q: The Tropical regions are likely to have more biological diversity than the Temperate ones. Give two…
A: Biome is the distinct ecological community of animals and plants that exist together in a particular…
Q: 1. The recessive Drosophila mutation bobbed (b) is located on the X chromosome and causes short…
A: This evaluation can be made by using punnett square.
Q: estions 1-2: Describe an appropriate control for each of the following. An investigator studies the…
A: In an experiment control is used when the independent variable is removed or set at standard value.…
Q: 6. What are carbohydrates? * O Different combinations of amino acids O Lipid monomers held together…
A: Macromolecules are large, complex molecules that are essential to the structure and function of all…
Q: I was told the correct answer is 0.006. Please advise why this one is diffrent
A: Introduction The fundamental piece of genetic information given from parent to child is the gene.…
Q: Compare and contrast life cycles of plants (pteridophytes, gymnosperms, angiosperm), animals, fungi…
A: Life cycles describe the progression of developmental stages that an organism goes through, from its…
Q: How can you tell if a protein is stably expressed over time by looking at a pulse-chase analysis gel…
A: Pulse-chase analysis is a method used to study protein synthesis and turnover in cells. In this…
Q: 2. Match the correct molecules with the checkpoints below. a. Molecules important for regulating…
A: There are various phases in the cell cycle and various checkpoints present so that if the DNA is…
Q: how many amino acids are in CAGATTGTGAAGAGGTCTCTTGA peptide sequence? Answer in numerical digits…
A: The DNA acts as the genetic element in most organisms. The genes are transcribed in mRNA. mRNA so…
Q: 1. On your ovulation chart, mark the unfertile, likely to be fertile, and the most fertile days. Put…
A: Menstrual liquid comprises blood, endometrial cells (uterine lining cells), and mucus. Menstruation…
Q: presented in this MMWR article, explain the trends that were seen with giardia infection across the…
A: The trends seen with Giardia infection across the nation from 2011-2012 showed an overall decrease.…
Q: What is a technique often used to study the three-dimensional structure of proteins? A.X-ray…
A: Proteins are made up of amino acids, which is the primary structure of proteins, the secondary…
Q: a. To make a 300mL of 1% NaCl, weigh cylinder, and add water to make the total volume b. To make a…
A:
Q: Choose an example of evolution that we have discussed in class. Use this example to demonstrate that…
A: Evolution is the process by which different species of organisms develop and change over time. It is…
Q: Deoxyribose sugar Thymine Guanine Phosphate Hydrogen bonds [Choose] [Choose [Choose ] [Choose ]…
A: DNA It is Deoxyribose Nucleic acid. It constitutes two polynucleotide chains that wound around each…
Q: Which of the following are forms of DIRECT transmission? Question 18 options: a) bite of…
A: Direct transmissions are-- b. Sex e) touching another person h) talking closely with someone g)…
Q: Why is there loss of protein synthesis in hypoxic injury to a cell?
A: Protein synthesis is the process by which cells use genetic information to build and assemble…
Q: What Moniclonal antibody topics can one do research on ?
A: Monoclonal antibodies are proteins that imitate the immune system's capacity to combat harmful…
Q: Briefly describe multiple sclerosis. Include information about the location of lesions, aetiology…
A: Multiple sclerosis (MS) is a central nervous system illness, which means that it damages the brain…
Q: You inspect an ear of corn and find the following number of kernels: 461 red and starch, 142 red and…
A: Genotype is the genetic constituent of an organism. It is a specific genetic makeup of an organism…
Q: Which of the following statements is true about NHEJ (Non-Homologous End Joining) repair? a. This is…
A: Non-homologous end joining(NHEJ) is basically a repair pathway.It mainly repairs double-strand…
Q: 9. For organism Z, 2n = 36. What is the diploid chromosome number (2n) and DNA content (C) of…
A: “Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: Part II-A New Dilemma Suzanne and David decided that Suzanne would take the diagnostic test. In…
A: Both decided for Suzanne to undergo the diagnostic procedure. Suzanne and David are now faced with a…
Q: Using the techniques below in the laboratory experiments, devise a detailed methodology in solving…
A: DNA testing and analysis can identify an individual's unique genetic makeup and help tailor…
Q: Can you Describe in 1500 words, Planning Cycle for a Health Program?
A: Health program basically means to provide basic preventive ideas to prevent the spread of…
Q: Per the book the answer to this questions is probability is 0.006.
A: The cross is between parents having genotype AaBb x Aabb. This genotype will produce four and two…
Q: Draw a molecule of DNA undergoing theta replication. On your drawing, identify (a) the origin of…
A: DNA is a double stranded molecule. DNA replication is Semi conservative. This means that each DNA…
Q: Given a chance to become a bioentrepreneur, which of the plant products will you be able to place in…
A: The question is about a hypothetical scenario in which a person has the opportunity to become a…
Q: What is the difference between quantitative and qualitative analysis? Give several examples. Define…
A: Quantitative analysis : Quantitative analysis is expressed in numbers and graphs. It is used to test…
Q: Distinguish between sensory and motor pathways in terms of direction and type of information…
A: In motor pathways the direction of information flowed from the cortex to the spinal cord and motor…
Q: Interactions of Agrobacterium tumefaciens with its host plant. Please describe how this plant…
A: Agrobacterium tumefaciens is a bacterium that infects dicotyledonous plants and produces crown…
Q: Genetic and genomic research can have social and environmental implications.
A: Genetic modifications do have environmental implications which can be observed from the given graph.…
Q: 1. Following Glycolysis, the second stage of cellular respiration is the Krebs (or citric acid)…
A: The Krebs cycle or TCA cycle or tricarboxylic acid cycle or Citric acid cycle is a series of enzyme…
Q: The waved albatross feeds exclusively on marine organisms and has no access to fresh water. It has…
A: Albatrosses have salt glands just behind their eye sockets. This salt gland allows them to get rid…
Q: Is it possible for two parents with achondroplasia to have a average height son (if so how often…
A: One in 20,000 infants have the inherited bone disease achondroplasia. The youngster has the most…
Q: What controls the direction of movement of ions across the membrane? A. Peripheral proteins B.…
A: The creation of ion gradients across the plasma membrane is necessary for the flow of ions through…
Q: Describe what a pseudogene is and what impact they have on gene expression
A: A pseudogene is a nonfunctional gene that can be compared to junk DNA.
Q: 2. Which of the following is NOT part of a nucleotide? O Phosphate O Sugar O Glycerol Nitrogenous…
A: As the question contains more than one questions, here we have answered the second question.…
Q: What is the most common portal of entry? Question 12 options: a) food & water b) mucous…
A: E. Respiratory aerosols
Q: The nurse practitioner prescribed 500 micrograms of Risperidone. The stock solution available in a…
A: Risperidone is an atypical antipsychotic medication used to treat schizophrenia and bipolar…
Q: What is the role of mRNA in protein biosynthesis process? Transfers amino acids to ribosome To bring…
A: Cells create proteins through a mechanism known as protein synthesis. Transcription and translation…
Q: Considering its metabolic properties, what advantage might the phototroph in the “Chlorochromatium…
A: Introduction: A phototrophic consortium known as Chlorochromatium aggregatum may be the highest…
Q: Make clear your understanding of polyneuropathies by providing the type of structure affected (its…
A: Nerves allow us to feel and respond to our environment. Nerves control the muscles, allowing us to…
Q: How does pollination take place in water hyacinth and water lily
A: Pollination: The process of transfer of the pollen grains from the anther which is the male…
Q: shirt (Sample A, n=83, Sample B, n = 19). Women at high conception risk were substantially more…
A: First let's try to understand these terms clearly:
Q: B. Write the function/s of each part of the microscope listed below. a. Eyepiece b. Draw tube c.…
A: An instrument, microscope is used to observe tiny objects even cells. It examines the objects that…
Q: X-ray crystallography is time-consuming and technically difficult. Why is the effort to understand…
A: biological molecule worthwhile helps to understand the fundamentals of biochemical processes…
Step by step
Solved in 3 steps
- A patlent has been prescribed 1.25 mg ramipril capsules 43h poat myocardial infarction. How many capaules need to be dapenned for a 14 dey supely Assume that ramipril is wel tolerated 1. Name of the medicinal product Ramipril 1.25 mg capsules, hard 2. Qualitative and quantitative composition Ramipril 1.25 mg, capsules, hard contains 1.25 mg of ramipril For the full list of excipients, see section 6.1. Symptomatic heart failure Starting Dose: In patients stabilized on diuretic therapy, the recommended initial dose is 1.25 mg daly. Titration and maintenance dose Ramipril should be titrated by doubling the dose every one to two weeks up to a maximum daily dose of 10 mg. Two administrations per day are preferable. Secondary prevention after acute myocardial infarction and heart failure Starting Dose After 48 hours, following myocardial infarction in a clinically and haemo dynamically stable patient, the starting dose is 2.5 mg twice daily for three days. If the initial 2.5 mg dose is not…1. Enumerate the different factors that interfere with the validity of prothrombin time (PT) results. 2. What will be the effect in prothrombin time if the patient is receiving therapeutic heparin? 3. Prothrombin Time is performed diagnostically when any coagulopathy is suspected. Explain the expected results of PT on the following coagulopathies: 3.1 Disseminated Intravascular Coagulation 3.2 Liver Disease SERUM PROTHROMBIN TIME 3.3 Vitamin K Deficiency 4. Illustrate and label the different steps of Serum Prothrombin Time.2. What will be the effect in prothrombin time if the patient is receiving therapeutic heparin? 3. Prothrombin Time is performed diagnostically when any coagulopathy is suspected. Explain the expected results of PT on the following coagulopathies: 3.1 Disseminated Intravascular Coagulation 3.2 Liver Disease SERUM PROTHROMBIN TIME 3.3 Vitamin K Deficiency 4. Illustrate and label the different steps of Serum Prothrombin Time.
- UHU UNIVERSITY HOSPITAL BED # 1 DATE: 8/30 TIME: 1700 ADMISSION DATABASE Yellow PRIMARY PERSON TO CONTACT: Name: Maria Rodriguez DOB: 12/19 (age 38) Physician: A. Gustaf, MD ☐ Green ☐White Name: Emilio Santiago (brother) TRIAGE STATUS (ER ONLY): ☐ Red Initial Vital Signs Home #: 555-212-7890 TEMP: 102 RESP: 32 SAO2: HT (in): WT (lb): 110 5'2" UBW 145 B/P: 78/60 PULSE: 68 LAST TETANUS 5 years ago LAST ATE yesterday LAST DRANK water 1 hour ago Work #: 555-213-4563 ORIENTATION TO UNIT: ☑Call light ☑Television/telephone ☑Bathroom ☑Visiting ☑ Smoking ☑Meals ☑Patient rights/responsibilities CHIEF COMPLAINT/HX OF PRESENT ILLNESS "I found out I had an ulcer 2 weeks ago. Last night I seemed to have gotten worse. I have been vomiting, and I have diarrhea. My pain is terrible. I think I have blood in my vomit and my diarrhea." ALLERGIES: Meds, Food, IVP Dye, Seafood: Type of Reaction Codeine causes nausea and vomiting. PREVIOUS HOSPITALIZATIONS/SURGERIES For delivery of her two daughters only…1. Which LDH isoenzyme is elevated in myocardial infarction? 2. What LDH isoenzyme can be use as a liver function test? 3. Enumerate the LDH isoenzymes and give disorders associated in each.PO Aav DAV == AaBbCcDdEe AaBbCcDdEe AaBb CcD AaBbCcDdE Normal M H No Spacing Heading 1 Heading 2 Question 5 a) Explain the general principles by which medical images may be obtained through the use of radiopharmaceuticals and a gamma camera. b) Explain the use of radiopharmaceuticals in i) Myocardial perfusion scans ii) Skeletal scintigraphy 20 ¶
- A physician order s Sentamycin 40mg lvqah fur a'child who The recommended do3age fur childrenis 3 - bmgl ) weighs 24 1bs. Kgl day In three divided doses . a what recummended minimum E maseimum daily dosages are the for this child ? b) what are the cmmended minimum single recor dosages fur this child? c) Is the ordered dosage safe ?1. Canagliflozin or Exenatide for DM2 in Stage 4 CKD Preference: Rationale: 2. Apixaban or Dabigatran for Artrial Fibrillation in Stage 4 CKD Preference: Rationale: 3. Enoxaparin or Heparin for DVT prevention in the hospital in Stage 4 CKD Preference: Rationale:1. route of administration for ISDN 5mg given for chest pain 2. Indication for lactulose 3. PRN for increase ICP
- The plasma of half-life of aspirin is t1/2 = 20 minutes; ibuprofen t1/2 = 2 hours. Both agents are dosed q 4 to 6 hours. Compared to ibuprofen, APAP's dosing can be much longer than it's plasma half-life because it is: 1. more toxic, so cannot be taken as often 2. more selective for COX1 than is ibuprofen 3. an irreversible inhibitor8) An order is written for 10 mL of a 10% calcium chloride injection and 10 mL of multivitamin o) An order is written for 10 mL of a 10% calcium chloride iniection and 10 mL of multivitamin Injection (MVI) to be added to1000 ml. of D5W. The infusion is to be administered over 6 hour* me iv set delivers 10 drops/ mL. What should be the rate of flow in drops per minute to deliver this infusion? normal saine is0.9%odum chloriee access TPN/P Perisher 9) A nurse hangs a bag of D51/2 NS with 20meg kcl. The bag is a 1 liter bag and needs to be infused at 120ml/hour. She needs to deliver a bolus of fluid first of 200ml to be infused in 30 minutes before she can run the regular IV rate. She has an IV set that is 10gtts/ml. She gets off work at 6pm and wants to know if she will need another bag of IV fluids before she leaves work. It is currently noon. The bag of fluids will run out at what time?1. The nurse is caring for Mr. Adrian, an 82-year-old man with CHF who has a past medical history of diabetes and renal insufficiency. He is prescribed digoxin (Lanoxin) 0.125 mg IV and then 0.125 mg PO daily.a. What are the therapeutic effects of cardiac glycosides?b. Is this patient at risk for digoxin toxicity? Explain.c. What are the adverse effects of digoxin?Discuss the nursing considerations for digoxin administration.