1. The pedigree below is for a rare but relatively mild hereditary disorder of the skin. How is the disorder inherited? Give reasons for your answer. I a. b. Give genotypes for as many individuals in the pedigree as possible. C. Consider the four unaffected children in Gen IV of parents III-4 and III-5; what is th probability that the parents III-4 and III-5 would have 4 unaffected children? OT
Q: You observe some bark beetles with different feeding behaviors. You find that the behavioral…
A: Trait is a characteristic feature unique to specific individual. Each trait is represented by…
Q: How does the slope of a line on a graph indicate rate (such as rate of transpiration)
A: The graph is consists of x-axis that has independent variable, y-axis that has dependent variable…
Q: A study was done with mice to see if there is a biological basis behind compatibility in friends and…
A: Social integrity: This element of Levine's theory emphasizes the relevance of interpersonal or…
Q: A few finches from the mainland get caught in a strong wind and end up colonizing a new island.…
A: Hardy Weinberg (HWE) principle – In HWE the genotype frequencies and allele frequencies of a…
Q: A classic dataset on wing coloration in the scarlet tiger moth (Paneaxia dominula) shows that…
A: A trait is a characteristic feature that is unique to particular individual. Each trait is…
Q: Which manifestations of liver disease are due to hepatocellular failure and which are due to portal…
A: Liver disease Applies to many conditions that stop the liver from working or prevent it from…
Q: Becker muscular dystrophy is due to a mutation in the same gene that causes the more severe Duchenne…
A: Given Disease is X linked recessive Father is affected = XaY Father's daughter is carrier = XXa…
Q: A researcher investigates the effect of eight different pH levels on the reactions catalyzed by the…
A: Enzymes are proteins which function as biological catalysts to help regulate chemical reactions.…
Q: Why does the carbon footprint calculator ask where you live.
A: Global warming is the major problem nowadays as it is leading to drastic climatic changes. Green…
Q: How can biology be related to love? Explain.
A: Love has a strong biological basis. Every area of our existence is influenced by it, and it has…
Q: How Metastatic tumors arise ?
A: The tumor is the term given to the mass of cells or tissues formed when the cells of that tissue…
Q: Explain why it makes sense for the PDH complex in liver to be active when dephosphorylated.
A: Pyruvate Dehydrogenase Complex(PDH) is a multienzyme complex that is involved in pyruvate…
Q: Our garbage collectors helps keep our city from the unnecessary waste everywhere, they are like…
A: An organelle is a specialised subunit of a cell that performs a specific function in cell biology.
Q: information? Discuss how things that we do to our bodies (smoking, recreational drugs, employment…
A: Genes makeup a person who we are that is genes ultimately expresses themselves in the form of…
Q: Make an illustration of dichotomous key with these animals.
A: The dichotomous key is the key that helps in identifying particular organisms. It involves two sets…
Q: ATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAAT…
A: The simplest definition of gene expression is the production of the gene's complementary protein,…
Q: Importance of functional groups in biological system with at least two examples?
A: Introduction When a molecule contributes in a living organism's biological reaction or process, it…
Q: homologous
A: Chromosomes are found in the nucleus of living cell . Which are hereditary materials for living…
Q: The image of these living HeLa cells are most likely from:
A: Different types of microscopy are used in the magnification and imaging of cells. Some routinely use…
Q: How is neurotransmission of pain signals modulated at the receptor, spinal cord, and brain?
A: Acetylcholine is a neurotransmitter that is synthesized from acetyl-CoA (ACoA) and choline obtained…
Q: If nuclear DNA replicates during the S (synthesis) phase of the cell cycle, when does mitochondrial…
A: The cell division in eukaryotes follow a cyclical events in which the the cell grow in size,…
Q: Is the Triple-Sugar Iron Agar (TSIA) a complex or defined medium? Explain based on its composition.…
A: Introduction A solid or liquid substrate that can be used to grow cells or organ explants; a medium…
Q: Factors affecting enzyme activity
A: Enzymes Enzymes are the biological catalyst that reduces the activation energy needed for starting…
Q: Investigators enrolled 100 diabetics without eye disease in a cohort (follow-up) study. The results…
A: The incidence rate is a measurement that provides how quickly a disease is transmitted in a…
Q: Define about this ? "Predisposition to Some Cancers Can Be Inherited"
A: Introduction: Cancer is a genetic disease that is caused to somatic cells. Cancers are associated…
Q: ADDITIONAL METRIC SYSTEM PRACTICE 1. Practice using metric length measurements by performing the…
A: Bacteria are prokaryotic simple unicellular and microscopic they may from filament or thread like…
Q: Between Ithaca and Geneva, NY at the old Seneca Army Depot is a herd of white tailed deer…
A: From the question given,we can understand that the white trait is recessive and the brown is…
Q: If I have to compare this organelle to the offices in the city, it is the Cotabato Light Company for…
A: Cell is the basic structural and functional unit of life. It has various organelles such as…
Q: Discuss the relationship between viruses and endocytosis. Compare bacteriophage AND animal viruses…
A: Endocytosis is the engulfment of any molecule inside the cell membrane of the host. Receptor…
Q: Caspases are responsible for ?
A: Caspases enzyme belongs protease enzymes family. They are named caspases due to their specific…
Q: Why do we need endonucleases to cut DNA if we are 60-70% water that was shown to hydrolyze phosphate…
A: A bacterial protein termed restriction enzyme, also known as restriction endonuclease, cleaves DNA…
Q: 1. Graded potentials are short lived and travel only short distances. Action potentials are long…
A: Graded potential: its the change in electric potential across the membrane of an excitable cell like…
Q: A blue eyed agouti hair male mouse is mated to a brown eyed yellow haired female mouse, and a test…
A: Introduction The term "phenotype" describes an organism's observable physical characteristics, such…
Q: You find yourself standing next to a beautiful rose bush. Which of the following do you and the rose…
A: Eukaryotic organisms are those that have well-defined organelles. These have relatively large-sized…
Q: Compute the A+C:T or U ratios of your DNA and RNA models. Do you expect the same values for DNA and…
A: According to Chargaff's rule, in a dsDNA, amount of guanine is always equal to C and amount of A is…
Q: How do feedback mechanisms control the secretion of hormones?
A: Hormones are chemical messengers which are produced by the various glands in the human body and…
Q: 7. 1 Required Study the two diagrams below. Diagram A 1 2 Diagram B 2 Based on the sequence of steps…
A: Active transport is a type of transport process that helps to move molecules through the cell…
Q: increase in atmospheric level of ____ is leading to a ____ in the ph of oceans
A: Atmosphere The layer of air that envelope the planet Earth. It provides air that we breathe.
Q: An ecosystem is made up of onlyl trees and animals in a habitat all living organisms (unicellular…
A: Living organisms can not live alone. All species are dependent on one another to meet their…
Q: 1. What is the importance of using freshly prepared KOH?
A: KOH (Potassium hydroxide) is an inorganic chemical compound which is highly alkaline in nature,…
Q: Which memory would you like to improve, and why? Semantic, episodic, procedural
A: Memory in human:- Memories in human brains may be short term or long term. Short term memory of…
Q: We compared the speed of transduction of the taste of sour vs either sweet or bitter, depending on…
A: A taste receptor is a type of cellular receptor found in the taste buds of papillae. When a food…
Q: Why is water such a unique molecule?
A: Biochemistry is a part of science that majorly deals with the study of bio-molecules found within…
Q: What are predisposition genes? why are the responsible for cause of cancer ?
A: Humans are predisposed to learn things like language and the notion of self from birth. Negative…
Q: How old are the first recognizable mammals relative to the K/T boundary layer (i.e., extinction of…
A: We are allowed to do upto three subpart of a question. Please repost the undone question again.…
Q: Which of the following will NOT happen either in prophase, metaphase, anaphase, telophase? O DNA…
A: Introduction Life is based on cell division and cell cycle. Cell cycle and cell division are…
Q: It means both dominant and recessive traits heterozygous homozygous genotype phenotype
A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…
Q: You are developing a porous membrane for use in a dialysis system. The membrane must be able to…
A: Explanation: Detailed explanation: The difference in pressure that exists between the inlet and…
Q: What causes regular cocaine users to chose that "initial high"?
A: Cocaine, a highly addictive stimulant narcotic, is derived from the leaves of the South American…
Q: data alone, what can you conclude about the roles of environment and genetics in hearing loss?…
A:
can you help with question 1 plz. thank you!
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- A couple was referred for genetic counseling because they wanted to know the chances of having a child with dwarfism. Both the man and the woman had achondroplasia (MIM 100800), the most common form of short-limbed dwarfism. The couple knew that this condition is inherited as an autosomal dominant trait, but they were unsure what kind of physical manifestations a child would have if it inherited both mutant alleles. They were each heterozygous for the FGFR3 (MIM 134934) allele that causes achondroplasia. Normally, the protein encoded by this gene interacts with growth factors outside the cell and receives signals that control growth and development. In achrodroplasia, a mutation alters the activity of the receptor, resulting in a characteristic form of dwarfism. Because both the normal and mutant forms of the FGFR3 protein act before birth, no treatment for achrondroplasia is available. The parents each carry one normal allele and one mutant allele of FGRF3, and they wanted information on their chances of having a homozygous child. The counsellor briefly reviewed the phenotypic features of individuals with achondroplasia. These include facial features (large head with prominent forehead; small, flat nasal bridge; and prominent jaw), very short stature, and shortening of the arms and legs. Physical examination and skeletal X-ray films are used to diagnose this condition. Final adult height is approximately 4 feet. Because achondroplasia is an autosomal dominant condition, a heterozygote has a 1-in-2, or 50%, chance of passing this trait to his or her offspring. However, about 75% of those with achondroplasia have parents of average size who do not carry the mutant allele. In these cases, achondroplasia is due to a new mutation. In the couple being counseled, each individual is heterozygous, and they are at risk for having a homozygous child with two copies of the mutated gene. Infants with homozygous achondroplasia are either stillborn or die shortly after birth. The counselor recommended prenatal diagnosis via ultrasounds at various stages of development. In addition, a DNA test is available to detect the homozygous condition prenatally. What is the chance that this couple will have a child with two copies of the dominant mutant gene? What is the chance that the child will have normal height?A couple was referred for genetic counseling because they wanted to know the chances of having a child with dwarfism. Both the man and the woman had achondroplasia (MIM 100800), the most common form of short-limbed dwarfism. The couple knew that this condition is inherited as an autosomal dominant trait, but they were unsure what kind of physical manifestations a child would have if it inherited both mutant alleles. They were each heterozygous for the FGFR3 (MIM 134934) allele that causes achondroplasia. Normally, the protein encoded by this gene interacts with growth factors outside the cell and receives signals that control growth and development. In achrodroplasia, a mutation alters the activity of the receptor, resulting in a characteristic form of dwarfism. Because both the normal and mutant forms of the FGFR3 protein act before birth, no treatment for achrondroplasia is available. The parents each carry one normal allele and one mutant allele of FGRF3, and they wanted information on their chances of having a homozygous child. The counsellor briefly reviewed the phenotypic features of individuals with achondroplasia. These include facial features (large head with prominent forehead; small, flat nasal bridge; and prominent jaw), very short stature, and shortening of the arms and legs. Physical examination and skeletal X-ray films are used to diagnose this condition. Final adult height is approximately 4 feet. Because achondroplasia is an autosomal dominant condition, a heterozygote has a 1-in-2, or 50%, chance of passing this trait to his or her offspring. However, about 75% of those with achondroplasia have parents of average size who do not carry the mutant allele. In these cases, achondroplasia is due to a new mutation. In the couple being counseled, each individual is heterozygous, and they are at risk for having a homozygous child with two copies of the mutated gene. Infants with homozygous achondroplasia are either stillborn or die shortly after birth. The counselor recommended prenatal diagnosis via ultrasounds at various stages of development. In addition, a DNA test is available to detect the homozygous condition prenatally. Should the parents be concerned about the heterozygous condition as well as the homozygous mutant condition?1. The pedigree below shows the incidence of rare, autosomal dominant disorder called Ehlers-Danlos disease. The pedigree covers three generations of a particular family and also shows individual genotypes at a potential marker locus (M). a) Indicate the phase of all gen II and III individuals. DdM1M3 ddM2M6 II DDM3M6 ddM4M5 III DdMзM4 DdMЗМ5 DDM3M4 ddM3M5 DDM3M4 ddM5M6 DDM3M4 ddM4M6 ddM5M6 ddM5M6 b) Which, if any, of the gen III individuals are recombinants? c) Calculate the LOD score as a test of physical linkage between the marker (M) and the disease locus. d) What do you conclude about linkage between D and M?
- Pedigree 2: A. What is the most likely mode of inheritance of this disease? Choose from: autosomal dominant, autosomal recessive, X-linked dominant, X-linked recessive. B State the genotypes of individuals # 1 #4. C If individual #3 has another daughter with the same partner, what is the probability that this daughter will be affected (show the disease)?II. Given the following pedigree below, use Punnett squares for each of the following possibilities: a) X- linked dominant and b) X-linked recessive in order to determine what is the mode of transmission of this trait. Disease allele = XA or Xª, depending on mode of transmission of the disease respectively. *Unaffected/No carrier-Normal Unaffected X chromosome = X I || III 1 1 2 a) X-linked recessive 9 III 6 genotype (circle one): XX * 1 2 3 11x12 4 ΧΑΧΑ 2 5 xaxa *4 6 7 8 b) X-linked dominant 11 x 12 오 XAX хахComplete the following queatione BEFORE ATTEMPTING THE HW 1 BLACKBOARD ASSIGNMENT, In the following human pedigrees, the filled symbols represnent the affected individuals who suffer from the disease. Use A/a to represent alleles for autosomal traits and XIX/Ytorepresent alleles for X-linked traits. Use the uppercase letter to represent the dominant allele and the lowercase letterto represent the receasive allele. afected fomale Unafected female affected male Unaffected male Pedigree 1: A. What is the most likely mode of inheritance of this disease? Choose from: autosomal dominant, autosomal recessive, X-linked dominant, X-linked recessive. B. State the genotypes of individuals #1-#3. C. What is the probability that individual #4 is a carrier of this disease if his mother is homozygous dominant and his father is heterozygous? Pedigree 2: What is the most likely mode of inhentance of this disease? Choose from: autosomal dominant, autosomal recessive X-linked dominant X-linked recessive.…
- Please consider the pedigree below. There are no cases of false paternity. I II III IV в 1 a. Which individual/s definitely has/have Bombay phenotype in the descendants of I-1 and I-2? b. What are the genotypes of individuals II-2 and III-2 at the AB0 and H loci? Please label your answers a and b, Il-2: and Ill-2:.Consider the following pedigree. 하 3 10 (5 3 2 (a) What pattern of transmission is most consistent with this pedigree? (1) autosomal recessive, (2) autosomal dominant, (3) X-linked recessive, (4) X-linked dominant. (b) If individual V-2 marries a normal individual, and if the condition has a pene-trance of 85 percent, what is the probability that their second child will express the trait? (c) On the third line, what does the diamond with a 10 in the middle mean?1. The figure below represents a karyotype performed on a somatic cell of an unknown organism. Answer the following questions using the figure. a. Circle (and label) 3 different sets of homologous chromosomes? b. This individual is heterozygote for gene A (Aa), Homozygote recessive for gene B (bb) and gene homozygote dominant for gene c (CC). Also, gene B and gene C are linked. Using the homologous chromosomes you circled in part a), provide a representation of the location of the A, B and C, genes and alleles on the homologous chromosomes and sister chromatids in such a way that is consistent with the scenario described above in part b). Choose the chromosomes of your liking to show an appropriate representation. TMIID IL MI
- a. How many generations are presented in this pedigree? b. What are the most probable genotype of III-3, IlI-5, and III-8? c. What is the probability that II- 1 and Il-2 will have another normal offspring? Show punnet square and explain your answer. d. Who among the individuals are affected?9. Make a pedigree for each of the following situations. For each individual, write the individual's genotype (when possible) next to the individual's symbol (e.g. O xty, I Gg): a. Two parents do not have cystic fibrosis and they have a daughter with cystic fibrosis and a son who does not have cystic fibrosis. The daughter grows up and she mates with a male who does not have cystic fibrosis. Their only child is a boy and he has cystic fibrosis. b. A man with hemophilia mates with a female without hemophilia. They have one son and one daughter. The daughter has hemophilia and the son does not have hemophilia. The son grows up, and he marries and mates with a female. Their only child is a boy, and he has hemophilia.1. In the pedigree below, Use "A" for the allele associated with the dominant phenotype, and lowercase "a" for the allele associated with the recessive phenotype. Determine what is the most likely mode of inheritance of this disease (whether it is inherited as the result of an autosomal dominant or autosomal recessive trait). Write the most probable genotype for each individual based on the mode of inheritance you have determined. Show how all the partners are crossed and the expected offspring produced (You may use Punnett Square) 1 dró || IV