Q: Sulfamethoxazole is a type of sulfonamide antibiotic. Its absorbance ranges from 250-300 nm in a UV…
A: Sulfamethoxazole Sulfamethoxazole is a sulfonamide based bacteriostatic antibiotic, widely used to…
Q: In the following experiment, strain B mouse is subjected to sublethal irradiation and a bone marrow…
A: Innate and adaptive immune responses are characteristics of the immune system. The immune system's…
Q: In the following pedigree of an autosomal recessive trait, which individuals in generation III…
A: Autosomal recessive traits: The traits present on chromosomes other than sex chromosomes, the…
Q: a. Which characteristic found in the prey species is most likely to be advantageous for survival?…
A: Prey animals must always be on edge and lookout for their predation. In order, to survive they…
Q: what if a mutation resulted in the enzyme DNA polymerase III being non-functional? How would that…
A: The mutation is defined as the change in sequence of nucleotides in a gene. The mutation can either…
Q: e answer fast
A: Answer 17: -Kd value of antibodies is inversely proportional to their binding affinity. Hence,…
Q: Problem #3 In some plants, green pod color (G) is dominant to yellow pod color (g). If an individual…
A: The genotype of the population is a number of populations with the given genotype and is calculated…
Q: Two gene loci, A and B, are on separate chromosomes and alleles A and B are dominant over alleles a…
A: Dihybrid cross Is a mating experiment involving two creatures that are genetically identical in two…
Q: human evolution
A: genetic drift can result in the loss of rare alleles and decrease the gene pool. Genetic drift can…
Q: How does the study of plate tectonics help in understanding probable evolutionary events? Explain…
A: In this question we have to describe about how tectonic plates sliding result in evolution. See full…
Q: The patient of 40 years complains of intensive pains behind the breastbone, which are stopped by the…
A: Dear student since you asked a question with more than 3 subparts, we can only answer the first…
Q: Which of the following conditions will result to deactivation of a gene? a. histone methylation b.…
A: In this question we have to describe about regulation of genes . See full answer in step 2.
Q: Why was this row of evergreens planted on an Indiana farm?
A: Biofencing Is often referred to as Live Fencing. These are tree or shrub lines placed along farm or…
Q: Which of the following is not an example of constitutively expressed gene? a. genes for cell…
A: Constitutive genes are those genes which are not regulated by other genes. These genes expressed…
Q: a. Briefly discuss (using three sentences) how the concepts and/or techniques in molecular biology…
A: As COVID-19 was discovered in Hubei Province, China, in December 2019, COVID-19 has spread…
Q: b) Phenotypes of progeny from test cross: WT = 12, Circle nonparental (NP) classes above. Genotype…
A: Test cross This cross is done to identify the genotype of the individual. In this cross, the…
Q: In corn, purple kernels (P) are dominant over yellow kernels (p) and round kernels (R) are dominant…
A: The chi-square analysis is used in different experiment to compare the observed and expected data.…
Q: Cross #1: P: Homozygous scarlet-eyed males F₁ Fs Homozygous brown-eyed females X 1072 Wild-type…
A: Answer :- a) Phenotypic ratio of F2 generation is 9 :3: 3: 1, for wild type eye, scarled eye,brown…
Q: Discuss some issues raised involving the biosafety and ecological implications of the field-testing…
A: Genetic modification and biotechnology are two terms that are used interchangeably to describe a…
Q: Explain why many molecules that demonstrate significant absorption in the UV/Vis do not also…
A: UV/ Vis Ultraviolet–visible or UV/Vis refers to the absorption of the electromagnetic radiation in…
Q: ch of the ff. scenario, state whether the gene is up- or down-regulated and briefly explain the…
A: Enhancer is a cis-acting ( on the same gene it controls) DNA regulatory sequence which strongly…
Q: What kind of systems have been developed to detect CSCs? Describe by giving examples. Please explain…
A: Cancer stem cells are a very small number of cells in the tumor responsible for tumor growth.
Q: Why are population sizes not constant in biology?
A: There are phases in population growth. The population growth can't always be exponential (…
Q: Which of the following joints can be considered as never moves type? A) Fibrous joints B) Synostosis…
A: Introduction Joints are formed when different bones connect with others. Most joints allow the…
Q: Question 10 Which of the following statements is incorrect? O In delta notation of fatty acid…
A: Q. Which of the following statements is incorrect? 1.In delta notation of fatty acid…
Q: 12 Vertebrates Deuterostomes other Lophotrochozoa other Arthropods Mollusks Radiata Porifera Fungi…
A: Taxonomic distribution of the species found in the Rabosky's study.
Q: The somatic nervous system provides both excitatory and inhibitory signals t skeletal muscle. True…
A: Neurons are the structural and functional units of the nervous system. A neuron consists of the…
Q: What is the effect of linkage and recombination on gamete genotypes?
A: Nucleus is a main controller of the cell which comprises of thread like structure known as…
Q: Describe the type and strength of the relationship between number of chicks and predators. positive,…
A: Correlation coefficients are numerical measurement that determines the strength of a relationship…
Q: ividuals who are heterozygous for both eye color and hair form are said to be doubly heterozygous,…
A: Introduction In the mid-nineteenth century, Gregor Johann Mendel was the first to uncover the basic…
Q: Figure
A: The cross of the yellow round seeds with the wrinkled green is a type of dihybrid cross. The ratio…
Q: 22. A rat mother is a high licker/groomer. Her offspring will display: a. Low levels of…
A: The glucocorticoid receptor is an evolutionally conserved nuclear receptor to which cortisol and…
Q: A perfect flower is one in which both ________ and ______________ are present.
A: Flower The flower is defined as the reproductive part of the plant which contains male and female…
Q: Given this DNA strand: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ Identify the following: mRNA:…
A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…
Q: 1. What are the reasons why Philippine tarsiers cannot be found in Cebu despite it being near to…
A: The Philippine Tarsiers are endemic to Philippines. They are majorly found in the islands of Samar,…
Q: Skeletal muscles account for approximately 43% of the typical body mass. At rest, they use about 18%…
A: Skeletal muscles account for approximately 43% of the typical body mass. At rest, they use about 18%…
Q: Briefly discuss (using three sentences) how the concepts and/or techniques in molecular biology are…
A: Introduction Molecular biology:- It is the branch of biology that studies the molecular basis of…
Q: 41. In acute prostatitis, an exam of the prostate may find the gland to be: A. Nodular B. Cool and…
A: Please follow step 2 for detailed explanation.
Q: How are the structures of the pistil and stamen adapted for successful fertilization?
A: Flowers are angiosperm organs that specialize in sexual reproduction. Flowers are specialized organs…
Q: Question 4 In ducks, the allele for black feathers (B) is co-dominant with the allele for white…
A: Alleles Alleles are the two different varieties of same gene for example height is gene and long and…
Q: What is a dominant trait? Recessive trait? 2. Differentiate monohybrid cross from dihybrid cross. 3.…
A: Mendel is knows as the father of genetics. Genetics is the study of genes and heredity. Disclaimer…
Q: The following graph shows the AMPA/NMDA ratio in cells from rats that were either: naive, unpaired…
A: NMDA and AMPA are one types of glutamate receptors mainly present in neuron.
Q: F1 mice targeted using CRISPR/Cas9 and an HDR DNA fragment is the first choice when modeling a.…
A: During replication, there will be a tiny number of mistakes in the sequence every time this happens.…
Q: A correlation between two variables implies that ... one variable may or may not directly affect the…
A: ANSWER;-d) One variable directly affects the other variable. Explain;- Connection is a factual…
Q: Why are there so many serotypes of the same bacterial parent strain? O Mutability O Genetics All…
A: Serotype A group of same species having distinct surface antigen receptors.
Q: What is the importance and advanatge of detecting CSCs? Please explain in detail the main findings…
A: Cancer is a collection of disorders characterized by abnormal cell proliferation with the capacity…
Q: Suppose that in maroon-fronted parrots, the number of chicks born each year in a population is…
A: Competition is a interaction between species that happens when two or more species require the same…
Q: Q3. Using the mutated DNA parental template sequence, follow it through to the resulting polypeptide…
A: The gene or small portion of DNA undegoes transciption to form mRNA and then this mRNA undergoes…
Q: Consider the following graph of an action potential: 60- 30- membrane potential (mV) O -30- -60 line…
A: Action potential refers to the sudden rise and fall of membrane potential across a cellular membrane…
Q: What are some of the functional and evolutionary advantages of gnathostomes?
A: Gnathostomes are vertebrates that have jaws. Having jaws has an evolutionary advantage for this…
1. How does genetic drift affect human evolution? Discuss it and present possible evidences.
Do no just copy from somewhere, please.
Step by step
Solved in 2 steps
- 1. What could be the possible roles of genetic drift in human evolution? Discuss it and show possible evidences for each role. Do not just copy it from somewhere, please.1. What could be the possible roles of genetic drift in human evolution? Discuss it thoroughly and present possible evidences for these roles. Do not just copy it from somewhere, please.1. Describe the key components of Natural Selection and explain how the process of Natural Selection can lead to biological change 2. Describe the scientific discoveries of Gregor Mendel and how they help to support Darwin's Theory Of Natural Selection You can research Darwin's Theory of Evolution By Natural Selection to find the answer and the same with Gregor Mendel's scientific discovery
- 29. Natural selection is the primary driving force of evolution, but there are other mechanisms at play as well. Define the following means and explain how they contribute to the process of evolution.Step 1 The branch of Biological Sciences that deals with the study of genome is known as Genomics. The genome is the complete set of genetic information present in an organism. As per the guidelines, the answers for the first 3 questions are being provided here. The student is requested to upload the remaining questions separately. Step 2 Question 1: GWAS or Genome-wide Association Study is a method for identifying the genes that are responsible for giving an organism its phenotype. This method is very useful because - • It provides information on the SNPs that need our attention in order to know about the genetic risk for a particular condition in an organism. • The SNP identification makes it possible to understand the mechanisms that might cause the genetic risk and also might provide a scope to clarify the differences between the alleles. • This method can find genomic variants that cause a particular trait or disease in an individual. GWAS can solve problems such as - Finding out…1. Explain in 200 words how the Darwinian evolution can decrease or increase the frequency of an allele( or a more complex heritable trait, for that matter).
- 92. In natural selection, what is being selected for (or against)? gene genotype phenotype species mutations that arise on a chromosome1. In 200 words, explain the role of variation in evolution.1. Present possible evidences that genetic drift affect human population. Discuss this evidences comprehesively. Do not just copy from somewhere, I need evidences that shows that genetic drift has a role in human evolution. Thank you!
- 1. Does genetic drift affect natural selection? Yes or No? Discuss and explain it thoroughly. Do not just copy it from somewhere, please.1-A common misconception of evolution is that it should naturally eliminate "harmful" alleles/mutations if they do not assist survival or reproduction. Explain why this is inaccurate and how these "harmful" mendelian alleles persist within the human genome. In your response, give an example of a mendelian allele that causes a "harmful" genetic disease that does not appear to have a beneficial component. 2 - Name an allele that is "harmful" in homozygote arrangements yet "beneficial" in heterozygote combinations (*hint: there is one really great example in the textbook!) 3 - Explain why removing variation (even rare forms) from the genome of a species makes it susceptible to extinction. 4 - Explain in your own words Mendel's two principles of inheritance (independent assortment and segregation).7. A burned body is found after a warehouse fire. You cannot obtain nuclear DNA suitable for testing, but you are able to obtain a sample of the person's mtDNA. What challenge will you encounter when trying to identify the person using mtDNA? Everyone has the same mtDNA so you won't be able to narrow identity down. mtDNA is most useful for information on traits like hair color so it won't narrow things down much. mtDNA only shows patrilineal lineage so it will only show the father's mtDNA. mtDNA is time consuming and expensive; not all labs have the capabilities to test this.