1. Fill in the blanks in the table below regarding the similarities and differences between two cellular processes: DNA replication and transeription. DNA replication Transeription A separate helicase enzyme is recruited to unwind DNA (Yes/ No) Polymerase moves along the DNA template from 5' to 3' or 3' to 5"? The region on DNA from which the process starts is called: The size of bubble expands as the process contimues. (Yes/ No)

1. Fill in the blanks in the table below regarding the similarities and differences between two cellular processes: DNA replication and transeription. DNA replication Transeription A separate helicase enzyme is recruited to unwind DNA (Yes/ No) Polymerase moves along the DNA template from 5' to 3' or 3' to 5"? The region on DNA from which the process starts is called: The size of bubble expands as the process contimues. (Yes/ No)

Name: 2 1. Fill in the blanks in the table below regarding the similarities
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: 2 1. Fill in the blanks in the table below regarding the similarities and differences between two cellularprocesses: DNA replication and transeription.DNA replicationTranscriptionA separate helicase enzyme is recruited tounwind DNA (Yes/ No)| Polymer

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 23QP: How does DNA replication occur in a precise manner to ensure that identical genetic information is...

See similar textbooks

Similar questions

Review Figures 8.12 and 8.13. In cells, the primers for DNA synthesis are short strands of RNA, so each newly-synthesized strand of DNA has a segment of RNA al its 5 end. As replication proceeds, DNA polymerases remove these RNA segments and fill in the resulting gaps with DNA. However, the gaps at the very 5 ends of the new strands cannot be filled in with DNA. Why not? DNA replication leaves exposed about 100 nucleotides al the 5 end of each template strand, and these single-stranded ends are removed. What are the effects of this "end problem" on a cell's DNA as it continues to divide? FIGURE 8.12 DNA replication. Green arrows show the direction of synthesis for each strand. The Y-shaped structure where the DNA molecule is being unwound is called a replication fork. FIGURE 8.13 Discontinuous synthesis of DNA. This close-up of a replication fork shows that only one of the two new DNA strands is assembled continuously. The other is assembled in short segments.
During DNA replication, one of the new strands of DNA is synthesized continuously, while the other is synthesized as a number of separate fragments of DNA that are subsequently linked by DNA ligase. This is because O replication starts at many points on the chromosome RNA primers only anneal to one of the parental strands of DNA one of the parental strands is unwound slower than the other by helicase DNA polymerase III only synthesizes DNA in the 5' - 3' direction
Which of the following statements is NOT TRUE about genomic DNA replication? O A DNA replication begins at the origin of replication and proceeds bi-directionally O B. New nucleotides can be added by the DNA polymerase only to the 3 end of the growing strand O. Synthesis of new DNA is catalyzed by the enzymes called DNA polymerases OD. DNA replication is semi-conservative OE. DNA replication proceeds continuously on both parental DNA strands.
If a mutation occurred that prevented single stranded binding proteins from binding, the result would be: O Replication would not be initiated O DNA would be synthesized on the leading strand, but not the lagging strand Replicating would be initiated, DNA would unwind, RNA primers would be laid down, but DNA polymerase would not bind O The newly synthesized RNA would not be able to leave the DNA template Replication would be initiated, but RNA primers would not anneal to the DNA
Review Figures 8.12 and 8.13. In cells, the primers forDNA synthesis are short strands of RNA, so each newlysynthesized strand of DNA has a segment of RNA atits 5′ end. As replication proceeds, DNA polymerasesremove these RNA segments and fill in the resulting gapswith DNA. However, the gaps at the very 5′ ends of thenew strands cannot be filled in with DNA. Why not?DNA replication leaves exposed about 100 nucleotidesat the 5′ end of each template strand, and these singlestranded ends are removed. What are the effects of this“end problem” on a cell’s DNA as it continues to divide
PART 4: TERMINATION OF REPLICATION When the ends of linear chromosomes are reached there is a 3' overhang of single stranded DNA. This is because the RNA primer located at this position has been removed and DNA polymerase cannot replace that primer with DNA (without a primer). This apparent dilemma is solved by an enzyme called Telomerase. Telomerase extends the DNA at the end of chromosomes, called telomeres. Telomeres are stretches of repeated And yd 5 ITT 3¹ 5 TTTTT 3¹ LL 3' is in 35mming 5' Telomere Repeats TITTAGGG TTAGGG TTAGGG 3 5' CCAAUCCC of chromosomes. Telomerase 3 Telomere Repeats 5⁰ VITTAGGGTTAGGG TTAGGG TTAGGG 3 AATCCC AATCCC AAUG( CCAAUCCC 9.0 Telomerase 1. The RNA nucleotides part of the telomerase structure is used as the In ins DNA polymerase DNA sequences. Telomerase recognizes the repeated sequence, binds to it, and then lays down more nucleotides, lengthening the telomere. 3' Telomerase is composed of amino acids and RNA nucleotides. In the image above the amino…
3-5-8-DNA- DNA helicase- DNA ligose-DNA polymerase-DNA replication origin of replication-primase-RNA-RNA polymerose- single strand binding protein stort codon-stop codon-transcription -transiation to What is the name of this process?1 This process bepins ar a site where the X's e on the DNAColed What is the name for #27 What is the neme for #3? 5 What is #4 made.cf at Which number refers to an Okazaki fracment? What is the number of the enzyme that is eluing toeether Okazaldi fragments"
Match the enzymes involved in DNA replication with their function. Primase [ Choose ] [ Choose] Synthesizes short RNA segment to initiate new DNA strand Helicase Main enzyme that extends RNA primer by adding DNA nucleotides to it Stabilizes single-stranded DNA Relieves over-winding of DNA ahead of the replication fork Removes RNA primers preceding Okazaki fragment and replaces RNA nucleotides with DNA nucleotides Single-stranded binding proteins Unwinds DNA helix Synthesizes the ends of the linear chromosome Seals nicks between adjacent DNA segments DNA polymerase III [ Choose ] DNA polymerasel [ Choose ] DNA Ligase [ Choose ] Topoisomerase [ Choose ]
During DNA replication, the function of RNA primers is to Group of answer choices serve as a binding site for DNA ligase separate the two strands of the double helix to open replication "bubbles" serve as starting points for DNA strand elongation by DNA polymerase in the 3' - 5' direction prevent new-separated strands of DNA from rejoining serve as starting points for DNA strand elongation in the 5' - 3' direction by DNA polymerase
Consider the following segment of DNA, which is part of a linear chromosome: LEFT 5’.…TGACTGACAGTC….3’ 3’.…ACTGACTGTCAG….5’ RIGHT During DNA replication, this double-strand molecule is separated from the right to the left into two single strands and the replisome is moving from the right to the left of the segment. ___________ should be the template for the lagging strand synthesis. neither of the two strands the bottom strand both top and bottom strands the top strand
1. The diagram below depicts a DNA replication fork in a biological cell. The primer is shown by an arrow 5'-3'. A ATTATGTCTGGCCTTGAGTAAGGCTAATCACAT GCGTA GCAT Primer BTAATA TCATTC CGATT From the DNA diagram above, which ends (indicated as A, B, C & D) of the DNA template strand are the 5' and a. which are 3' ends? b. Which way is the direction of movement of the replication fork? Right or left of the figure. Which of the parental strands are the templates for leading (continuous) and lagging (discontinuous) strand synthesis?. Top or bottom strand. С. I d. Give the sequence of the five base long primer that is shown as an arrow in the diagram above 5' 3' Give the sequence of the next four bases that would be added to the growing end of the primer e. 5' 3'
What does i mean to say that extension by DNA polymerase III proceeds 5' 3'? The 5' end of a DNA polymerase molecule attaches to the 3' end of primase. DNA polymerase adds nucleotides to a growing strand, moving in the 5'-3' direction. O DNA polymerase seals nicks as it moves along a DNA strand toward the 3' end. DNA polymerase can only synthesize DNA at the 5' end of an existing strand of DNA. O O 0