QUESTION 3You are provided with plasmid DNA at 200ng/uL, 10X restriction digestion buffer, restriction enzymes (1unit/ul) and water. You want to digest 1.5 ug of plasmid DNA with 1 unit (U) of enzyme in 1Xbuffer in a total volume of 80 ul. Complete the table below:SolutionStock solution Working solution Volume neededrestriction digestion buffer 10X1XDNA200 ng/ul1.5 μεenzymes1 unit/ul1 unitWaterTotal80 μL

SolutionStock solutionWorking solutionVolume neededRestriction digestion buffer 10 X1 X8 lDNA200…

You are provided with plasmid DNA at 200ng/uL, 10X restriction digestion buffer, restriction enzymes (1 unit/μL) and water. You want to digest 1.5 µg of plasmid DNA with 1 unit (U) of enzyme in 1x buffer in a total volume of 80 µL. Complete the table below: Solution restriction digestion buffer 10X DNA enzymes Water Total Stock solution Working solution Volume needed 1X 200 ng/ul 1 unit/μL 1.5 μg 1 unit 80 μL

You are provided with plasmid DNA at 200ng/uL, 10X restriction digestion buffer, restriction enzymes (1 unit/μL) and water. You want to digest 1.5 µg of plasmid DNA with 1 unit (U) of enzyme in 1x buffer in a total volume of 80 µL. Complete the table below: Solution restriction digestion buffer 10X DNA enzymes Water Total Stock solution Working solution Volume needed 1X 200 ng/ul 1 unit/μL 1.5 μg 1 unit 80 μL

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

Question 11 1. An 9 kb circular plasmid is cut with the EcoRI restriction enzyme, and the reaction products are run on a DNA gel and stained with ethidium bromide. Bands of 1.0, 3.0 and 5.0 kb are seen. 2. When the same plasmid is cut with both the EcoRI and BamHl restriction enzymes (a double digest), bands of 1.0, 1.5, 3.0, and 3.5 kb are seen. From these results, it can be concluded tha v[ Select ] cuts within the BamHI [ Select ] v kb [Select EcoRI
QUESTION 6 To verify the is indeed inside your plasmid, you'd like to do a colony PCR. But you need primers for your reaction. Which of the following primer pairs would probably work for verifying your insert is actually present in the plasmid? 5' ATGTTTATTTTCTTATTATTTTTTACTCTCACTAGTGGTAGTGACCTTGACCGGTGCACCACTTTTGATG ATGTTCAAGCTCCTAATTACACTCAACATACTTCATCTATGAGGGGGG TTTACTATCCTGATGAAATTTT (Very long, but a bunch of nucleotides her e).... TCTTGCTTTGTTGCATGACTAGTTGTTGCAGTTGCCTCAAGGGTGCATGCTCTTGTGGTTCTTGCTGCAA GTTTGATGAGGATGACTC TGAGCCAGTTCTCAAGGGTGTCAAATTACATTACACATAA 3' Forward: 5' GGT AGT GAC CTT GAC CGG 3' Tm= 59.8 O A. Reverse: 5' CAA ATT ACA TTA CAC ATA A 3' Tm= 47.4 Forward: 5' ATG TTT ATT TTC TTA TTA TTT 3' Tm= 47.1 C O B. Reverse: 5' TAT GTG TAA TGT AAT TTG ACA CCC 3' Tm3 58.4 Forward: 5' GGT AGT GAC CTT GAC CGG 3' Tm3 59.8 OC. Reverse: 5' GTG TAA TGT AAT TTG ACA CCC TTG 3' Tm: 59.4 Forward: 5' GGT CAC TAC CAC TAG TGA GAG 3' 59.4 C O D. Reverse: 5' GTG TAA TGT AAT TTG ACA CCC TTG…
Question 22 Cloning vector contains a multiple cloning site (MCS) or polylinker containing multiple unique restriction sites. It also contains markers that allow for rapid selection of colonies with insert-containing plasmids in them. The 1st statement is True and the 2nd statement is False. The 1st statement is False and the 2nd statement is True. O Both Staments are True. O Both statements are False.
QUESTION 23 Below is a plasmid with restriction sites for BamHI and EcoRI. Several restriction digests were done using these two enzymes either alone or in combination. Which lane shows the fragments produced when the plasmid was incubated with both EcoRI and BamH1? Plasmid Bam HI. Bam HI OI O O 2 Kb O O || ||| IV V 4 Kb 6 Kb PGEN101 (20 Kb) Eco RI Bam HI 8 kb Base pairs 20 Kb 11 Kb 8 Kb 6 Kb 3 Kb I Gel lanes. || III IV V
QUESTION 17 OL NEere interested in generating a PCR amplicon including the bracketed sequence below. Which of the following sequences would be canen hybridizing (annealing) with the target AND would also serve to generate a copy of the bracketed region of interest? 5'-AATCGT[AGCAGCAGCAGTGGCT]A AGCT-3 3' -TTAGCA[TC GTC GTC GTC ACC G A] TTCG A - 5' 3-TTAGC-S S-AATCG-3 OSAAGCT-3 5-AGCTT-3 5-GCTAA-3 5-TCGAA-3 QUESTION 18 Vhich of the following is/are true regarding the enzvme PRIMASE? Save and Submit to save and submit. Click Save All Answers to save all answers.
Question 20 : The restriction map of the plasmid pSC48 is presented below. The numbers in parentheses correspond to the position of the respective restriction site with respect to position (0). (0) BamHI ЕcoRI (4640) (620) PSC48 5200 pb BamHI (1130) Smal ЕcoRI (3420) (1350) The plasmid has been digested by one or several restriction enzyme(s). The digestion products have been analysed by agarose gel electrophorese. (see figure below). 1 2 10,000 8,000 6,000 5,000 4,000 3,000 2,500 –2,000 - 1,500 -1,000 -750 - 500 -250 1. Digestion products 2. Size marker base pairs Which restrcition enzyme(s) have been used for the digestion? (Indicate the right answer) А- ЕсoRI. B- EcoRI/BamHI. C- EcoRI/Smal. D- BamHI. E- Smal. | |
nucleoplasm eukaryotic MRNA coding sigma core polymerase eukaryotic RNA nucleolus rho transcription factor eukaryotic RNA
QUESTION 2 The SARS-COV-2 pandemic resulted in the desire to design ELISA assays to either detect antibodies against SARS-CoV-2 protein (previous infection), or detect viral protein (current infection). You plan to express the mutant spike protein variant using the plasmid pictured below as your template. Here's the sequence you want to put in its place: https://www.ncbi.nlm.nih.gov/nuccore/AY429073.1?report=fasta, this is the DNA sequence you're going to buy as a gene block! But you need to add a couple things to it first so it'll get into the plasmid. To do so, you're going to need to remove the current insert (represented by the yellow arrow beginning at position 833-4867). Question: What restriction sites are you going to add at the ends of the gene? Answer can be in nucleotides or the enzyme name. For the first blank fill in the site name/sequence you'd add at the beginning of the gene (5' / C-terminus end) and for the second blank fill in the sequence/site name you'd add at the…
QUESTION 1 The sequence of a DNA including the gene that you want to clone into a plasmid vector. The gene of interest is in bold with the stop codon shown in green. The sequence has no suitable restriction site for digestion to isolate the gene fragment for cloning. Recognition site of Sal-I enzyme is given below. Design a primer to introduce the Sal-I site to the beginning of the gene. Write the complementary DNA sequence Design the primer and show which strand of DNA it is complementary to Mark the direction of all DNA sequences including the primer. 5-TGTCAGCACCATCTGTCCGGTCCCAGCATGCCTTCTGAGACCCAGGCAG(1500b)TGGGGCTGACTCTTTA-3 Sal-1 recognition site GTCGAC CAGCTG THIS IS COMPLETE QUESTION. PLEASE EXPLAIN EACH PART OF GTHE QUESTION.
QUESTION 5 Based on the plasmid shown, what will you have to use to to distinguish and isolate the bacteria that successfully took up the plasmid? O Lactose O Tetracycline O Ampicillin O UV light to identify the glowing colonies O Xgal
QUESTION 16 Consider each of the three calculation problems related to DNA extraction. A. What is the concentration of a DNA extract which was diluted 1:10 and had an A260 reading of 0.40? B. You elute the DNA sample above by adding 180 μl buffer. What is the total DNA yield, in ug? c. The A280 reading of the DNA sample is 0.24, and the A230 reading is 0.25. How pure is your DNA sample?
QUESTION 22 During the search for the Cystic Fibrosis (CF) gene the investigators used various criteria to conclude that they had arrived at a segment that represented a gene. Which of the properties below was among the criteria used by the investigators? O A. the presence of sequence palindromes O B. gene-specific restriction maps O C. interspecies sequence conservation O D. polyadenylation signals O E. the presence of AT-rich islands QUESTION 23 A feature common to activation of the myc oncogene by both the Avian Leukosis virus and the chromosomal 8:14 translocation is: O A. loss of the 1st myc exon (E1); initiation of transcription from a start site within the myc intron O B. Initiation of transcription from a strong promoter upstream from the first myc exon (E1) O C.A fusion transcript between an active upstream gene and the three myc exons O D.A DNA deletion that eliminates the transcriptional termination signal from an active upstream gene. O E. Recombination between the myc…