While proper filtration technique showed the location of the dye, it did not explain the process by which the dye moved to that location. Provide evidence that the dye moved to that location by active transport and not by simple diffusion.
Q: Which reaction is irreversible? oxidized glutathione + NADPH + H+ → reduced glutathione + NADP+…
A: Introduction: When a reaction is irreversible, it cannot be reversed, i.e. the products do not…
Q: Mitosis and Meiosis: Mastery Te X 不 b…
A: Introduction Cytology refers to the study of cells such as cell morphology, physiology, etc. As we…
Q: ermine the use of metagenomics to discover new pathogens and create antibiotics to eliminate them.
A: Antimicrobials are chemicals or substances that either stop bacteria from growing or actually kill…
Q: Please help
A: All these terms are different scientific terms which are hidden in this puzzle. The arrangement of…
Q: Analysis the features of a maize plant and classify it into the appropriate plant group
A: Plants are classified into different groups based on their features. The two main groups of plants…
Q: V. Materials. To be procured by each student: Genetic code VI. Procedure 1. Assume that a segment of…
A: DNA strand "A" = 5' TTCTTGTCATACTGCTGGCTGCCCCACCAGCGAATGGTGACAAACAAG 3' Note:-i answer according to…
Q: 4. The diagram below shows the process of protein synthesis. Label the numbered parts of the…
A: This picture represent the translation process which is the formation of polypeptide chain from…
Q: explain synaptic plasticity and neurophysiological changes to the mesolimbic system that occur…
A: Addiction was formerly thought of as a personal decision rather than a sickness. Finding effective…
Q: Individuals infected with herpes simplex virus (HSV) mount protective antibody responses directed…
A: 1. The alternative route is activated by Thr hydrolysis of C3 on the cell surface. In opsonization…
Q: Compare the mechanism of genetic recombination in linked and unlinked genes
A: Genes are the stretch of DNA that code for a polypeptide.
Q: DNA contains genetic code that determines... Ophysical traits O unobservable traits Ohow smart you…
A: DNA or deoxy ribo nucleic acid is main genetic material within eukaryotes such as humans. Their…
Q: Q4. Select the missing evaluation given the plant characteristic. Plant Characteristic Underground…
A: Due to their geophilic nature, the stems lack shade of green and are altered to conduct a variety of…
Q: 6. Originally, two species of finches lived in the Maldives. One species had long, narrow beaks…
A: Introduction : The steady transition of an organism from a simple to a more sophisticated form is…
Q: What are autotrophic organisms
A: Introduction Organisms can be classified into two on the basis of their food production. Autotrophs…
Q: The darkest part of the shadow is A. Umbra B. Penumbra C. Hyperumbra D. None of these
A: Introduction :- When an opaque item blocks light from a light source, it creates a shadow, which is…
Q: Determine the reason due to which it is possible that the translation of a single mitochondrial…
A: Given that tRNAs are impacted by numerous clinical mitochondrial illnesses brought on by mutations…
Q: . What is science ? A. Study of living things B. study of nature C. Study of law D. All of the above
A:
Q: 15. Antibiotics provide the best defense against viruses a. b. True a. b. False 16. Cocci bacteria…
A: Introduction Small, single-celled organisms are known as bacteria. Nearly all areas of the planet…
Q: 7 10 P Required HOW ARE PROTEINS MADE? STEP 1: mRNA strands are select.... the select.....…
A: Translation is a process by which cell makes proteins using genetic information carried in mRNA. It…
Q: Reductase is the Fe protein composed of two: polypeptide chains linked by three disulfide bonds.…
A: Nitrogenase reductase is an iron containing protein that accepts electrons from ferridoxin and…
Q: Determine the method of distinguishing whether the bacteria has penicillinase activity or if the…
A: Penicillin works by preventing the manufacture of peptidoglycan, which is a crucial part of both…
Q: Nonessential amino acids are those that: can be synthesized in the human organism if dietary…
A: Introduction Proteins are made up of amino acids, which have a number of crucial functions in the…
Q: Structure and functions of root hair cells?
A: The root hair cell is an epidermal offshoot that forms hairs of the root of the plant. Essentially,…
Q: There is no bird without feathers. A. true B. false
A: Birds: A class of warm-blooded animals known as the Aves, birds are distinguished by their feathers,…
Q: The distinguishing feature to identify whether mutation took place in plasmid or chromosomal genes.
A: Introduction: The F plasmid is exchanged from the F', which functions as the donor, to the F, which…
Q: What is an example of an adaptation that plants have that help them survive in different climates?
A: Plants have adaptations to help them survive in different areas or different climatic conditions.
Q: Which species richness represents a larger island that is farther from the mainland? The red lines…
A: New immigrants to the island primarily come from the mainland. Since closer islands are simpler to…
Q: Plants store glucose as _____ and _____. starch; sucrose fructose; sucrose galactose; fructose…
A: The complexity of physical and chemical processes involved in photosynthesis, respiration, and the…
Q: Page 5 of 10 761 words mana M m X English (United States)
A: This question is about labelling the diagram of a cell.
Q: Helicases are motor proteins that translocate on nucleic acids: Describe the structure of the…
A: Helicases are enzymes present in the body. Helicase is necessary for the movement of pumps present…
Q: What serves as a long-term Storage area for water or nutrients
A: The areas of Earth where life is present are referred to as the biosphere. The biosphere encompasses…
Q: A cross between an orange-brown male and a homozygous black female produce four kittens. What is the…
A: Given information The cross is between an orange-brown male and a homozygous black female. Black…
Q: Q1. Determine if the event occurs during mitosis or during meiosis. Copy and paste, mitosis or…
A: cell division: When a parent cell isolates and reproduces, it creates at least two daughter cells.…
Q: AA DNA strand DNA strand mRNA codon B tRNA anticodon Amino acid I Alanine CGT ACG CTC TAG CCA !!!! U…
A: Introduction DNA replication is the process through which cells make copies of the genome's DNA. A…
Q: Why is the dark reaction called a cycle
A: Plants create and produce oxygen by absorbing carbon dioxide from the environment through…
Q: population, and the number of mating events for both islands. Graph 2: Number of Iguana Mating…
A: Marine iguana usually have no inter-specific as well as intra-specific competition for the food.…
Q: Determine the reason due to which mutations in different genes of mitochondria cause different…
A: It goes without saying that the primary purpose of mitochondria is to produce ATP. The mitochondrial…
Q: How do plants use small organic molecules to grow bigger
A: Plants are known as primary producers because they produce their own food. They are able to produce…
Q: Rubisco requires a bound CO2 for catalytic activity. What happens with rubisco when CO2 is bound?…
A: A crucial enzyme in photosynthesis, Ribulose Bisphosphate Carboxylase/Oxygenase (Rubisco), is…
Q: The increase use of fossil fuels increases the Select one: O a. rate of photosynthesis of marine and…
A: Fossil fuels are the reserved fuels buried in the deep earth crust. The supply of fossil fuels is…
Q: If two unaffected parents have an affected child, they must be what of the gene
A: Given condition: Two unaffected parents have an affected child. This is possible only when both…
Q: An eighteen-year-old man is newly diagnosed with asthma.He experiences asthma symptoms nearly every…
A: Asthma is the most prevalent chronic illness in children and is a serious noncommunicable disease…
Q: What are the adaptations of the phloem cell?
A: Introduction Plants need a continuous supply of water and nutrients for their survival and growth.…
Q: Duchenne muscular dystrophy is a sex-linked recessive disorder characterized by a progressive loss…
A: Duchene muscular dystrophy is a X linked recessive trait. It is characterized by progressive loss of…
Q: about two Practice Practice creating a dihybrid cross are dominan characteristics in pea plants,…
A: Dihybrid cross: - A Dihybrid cross is defined as a cross between two individuals who differ in two…
Q: What does smooth muscle cell do to our body
A: Introduction Animals have four types of tissues found in their body. Epithelial tissue Connective…
Q: What kingdom monera
A: Introduction: Animal, plant, fungus, protist, and monera are the five kingdoms that make up the…
Q: 1. What are the ingredients the device? 2. Working principle 3. What are the common malfunctions…
A: Introduction Kidney stones are tiny solid masses made up of salts in urine formed inside the kidney.…
Q: Answer the following questions related to bias in screening studies. A- Explain in your own word,…
A: Lead time:- it is the time duration between the detection of a disease via screening or any…
Q: Visitors to Plimouth Plantation are often surprised by the low ceilings and narrow door frames of…
A: A population's heritable characteristics change over successive generations, resulting in evolution.…
My Biology Lab conducted an experiment that focused on the Active Transport of Yeast. Please anser the folowing question:
- While proper filtration technique showed the location of the dye, it did not explain the process by which the dye moved to that location. Provide evidence that the dye moved to that location by active transport and not by simple diffusion.
Step by step
Solved in 2 steps
- Discuss the differences between living and killed yeast cells transport across membranes.The following image shows part of counting chamber you used to estimate cell viability for yeast cells. If the dilution factor you used was 1:200, and the total sample volume was 5 ml, then calculate the cell viability, the cell density and the total cell.A clinical microbiologist is studying a microbe that can cause infections and gastrointestinal disease in humans, and which can also survive and reproduce in mice. A dormant cyst form of the microbe infects human hosts through fecal-oral transmission if they come in contact with mouse droppings and don’t wash their hands before eating. The organism grows in long filaments when grown at 20-28 deg C, and forms round/ovoid cells when grown at temperatures above 28 deg C. Sexual reproduction (fusion of haploid gametes) occurs in both humans and mice. A cell wall is present, and cells contain nuclei. This microbe could be which of the following? Bacterium Fungus Virus Protozoan
- Discuss the differences between living and killed yeast cells.In a reproduction of an experiment famously performed by Louis Pasteur, you cultured yeast in the absence of oxygen (anaerobic growth) and measured (1) the rate of cell division, (2) the rate of glucose consumption, and (3) the intracellular ATP:ADP ratio. You then moved the cells to an incubator containing normal atmosphere (i.e., 21% oxygen), completed a second set of measurements, and made the following observations: The rate of cell division increased considerably after the addition of oxygen (aerobic growth) Glucose consumption dropped dramatically after the addition of oxygen Intracellular ATP:ADP ratios increased significantly (from 2:1 in the absence of oxygen to 10:1 in the presence of oxygen) Explain how the mitochondria in the yeast contribute to the dramatic drop in glucose utilization and increase in ATP concentrations in the presence of oxygen.Numerous mechanisms are used by the different eukaryotic microbes for cellular locomotion. Please discuss at least 4 of these mechanisms for locomotion utilized by these cells for movement through their microenvironments. Be sure to state the specific organism (name drop please) that you are referring to and how this locomotion mechanism is used by the cell and by microbiologist for classifying microbial cells.
- Mammalian cell cultures often are used for experimentation. The cell culture medium typically is supplemented with penicillin to prevent bacterial contamination of the cell line. However, researchers know that this antibiotic will not prevent Mycoplasma growth. Explain why penicillin does not protect the culture from Mycoplasma contamination.Examples of inclusion bodies in bacterial cytoplasm are _____________ and _____________ .You have run tests on a new centrifuge to determine the flow rate at which yeast cells break through into the clarified liquid stream. This value was measured as 10 L/min. The yeast were previously found to settle at 100 µm/s in a lab centrifuge operated at 500 g. What is the Σ value of this new centrifuge?
- Why might clinical medicine have an interest in understanding bacterial cell division at the molecular level? Explain why a hyperthermophile would probably not be a human pathogen. Describe four factors that may have an influence on the effectiveness of an antimicrobial treatment. Explain why 70% or 80% alcohol is more effective than 100% alcohol in controlling microorganisms.In the diagram below, identify the structures of a cyanobacterial cell based on the following descriptions: a) Outer cellular covering which includes: Mucilaginous layer – outermost layer covering the cell wall; protects the cell from harmful factors of the environment Cell wall – found just below the mucilaginous layer; 2 or 3-layered, the inner layer lies in between the outer wall layer and plasma membrane; the outer layer is made of peptidoglycan Innermost plasma membrane – selectively permeable membrane enclosing the cytoplasm b) Cytoplasm – found below the plasma membrane; the protoplasm which contains structures of different shapes and functions. Lamellae, which contain pigments such as chlorophylls, carotenes, xanthophylls, phycoerythrin and phycocyanin, are located in the peripheral region of cytoplasm. Ribosomes may also be found scattered in the cytoplasm. c) Nucleic material – the nucleoplasm that is centrally located in the cell and contains chromatin in the form…If the diameter of the field of view in your microscope is 2 mm under low power, and one Bacillus cell is 2 µm long, how many Bacillus cells would it take to reach all the way across this field of view? If yeast cells measure 10 µm in length, how many yeast cells would it take to reach across this same field of view?