Which of the following correctly states a similarity between transcription in prokaryotes and eukaryotes?In both domains of life, RNA polymerase begins and ends transcription at the start and stop codons, respectively.In both domains of life, RNA polymerase reads the template strand from 5' to 3"In both domains of life, RNA polymerase synthesizes new RNA transcripts in the 3-5 direction.In both domains of life. RNA polymerase depends on additional proteins to bind to a promoter and subsequently initiate transcription.OIV.In both domains of life, transcription is independent of cis-acting sequences in the chromosome.V.

Transcription is a process of synthesizing a messenger ribonucleic acid [m-RNA] from the…

Which of the following correctly states a similarity between transcription in prokaryotes and eukaryotes? In both domains of life, RNA polymerase begins and ends transcription at the start and stop codons, respectively. O In both domains of life, RNA polymerase reads the template strand from 5' to 3'. u In both domains of life, RNA polymerase synthesizes new RNA transcripts in the 3-5' direction. In both domains of life, RNA polymerase depends on additional proteins to bind to a promoter and subsequently initiate transcription. y In both domains of life, transcription is independent of cis-acting sequences in the chromosome.

Which of the following correctly states a similarity between transcription in prokaryotes and eukaryotes? In both domains of life, RNA polymerase begins and ends transcription at the start and stop codons, respectively. O In both domains of life, RNA polymerase reads the template strand from 5' to 3'. u In both domains of life, RNA polymerase synthesizes new RNA transcripts in the 3-5' direction. In both domains of life, RNA polymerase depends on additional proteins to bind to a promoter and subsequently initiate transcription. y In both domains of life, transcription is independent of cis-acting sequences in the chromosome.

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 1TYK: Eukaryotic mRNA: usessnRNPs to cut out introns and seal together translatableexons. uses a...

See similar textbooks

Similar questions

The following fictitious double-stranded bacterial DNA sequence codes for a fictitious protein. Both strands are shown; the top strand reads 5' to 3' left to right, while the bottom strand reads 5' to 3' right to left. Transcription begins with and includes the red underlined A/T (top strand/bottom strand) base pair. This is a bacterial sequence, so there are no introns. 5'GTGTCCGTATGATATTGTGAGATGTTATATCCCGCCGTCAACACCATAAAACAGGATAATCGCCTGCTGGGGCAAAGGCGGTGAAGGTAAAGGTGTTGCC 3′ 3' CACAGGCATACTATAACACTCTACAATATAGGGCGGCAGTTGTGGTATTTTGTCCTAT TAGCGGACGACCCCGTTTCCGCCACTTCCATTTCCACAACGG 5′ a) Which strand is used as a template for transcription, the top or the bottom? b) What are the first 15 nucleotides of the resulting mRNA? Indicate the 5' and 3' ends. c) What is the translation of the first 15 nucleotides of the mRNA? d) Do the underlined nucleotides TAA encode a stop codon for the protein? Explain. e) A mutation occurs which results in the insertion of an extra G/C (top strand/bottom…
In which order do the following events occur in prokaryotic transcription (from 1 = first to 4 = last)? The new RNA strand detaches from the DNA template and RNA polymerase RNA is synthesized in the 5' to 3' direction RNA polymerase reaches the termination site RNA polymerase complex binds to the promoter
Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the above DNA strand is the template (antisense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription?
The following segment of DNA is part of the RNA-coding sequence of a transcription unit. If the bottom strand is template, which of the following RNA sequences would be transcribed? DNA: 5-'ATAGGCGATGCCA-3' 3'-TATCCGCTACGGT-5' O 5'-UAUCCGCUACGGU-3' O 5'-ACCGUAGCGGAUA-3' O 5'-AUAGGCGAUGCCA-3' O 5'-UGGCAUCGCCUAU-3'
Asap
Which of the following are features of transcription? -there is a direct interaction between nucleotides in the template DNA strand and incoming nucleotides being joined at the growing end of the RNA chain. -the RNA product remains permanently hydrogen-bonded to the template DNA strand. -the RNA being produced is elongated by addition of nucleotides at its 5' end. -the template DNA strand is "read" by RNA polymerase in a 3'-to-5' direction. -the site at which transcription starts is called the replication origin. More than one answer is right Please help me I’m confused
Where does transcription take place? nucleus cytoplasm ribosome mitochondria Why must transcription occur where DNA can be found? because DNA can't leave because ribosomes are in the nucleus because DNA polymerase is found there because helicase unzips the DNA How many nucleotides equal 1 amino acid? 1 3 TRANSCRIBE this DNA sequence: TACGTTACT AUGCAAUGA ATGCAATGA AUGGATUGA TACGTTACT É O O O O O O O O
The following DNA sequence occurs as the template strand: 3’ – TACGGGGATCAGATTATC – 5’ DNA template What single nucleotide deletion within the DNA sequence would cause a frame shift and a premature STOP codon? Write down the sequence of the New DNA template after deletion of the single nucleotide and also that of the New mRNA transcript, and specify the 5’ and 3’ ends of both the template and the mRNA transcript. Highlight the premature stop codon in the mRNA transcript.
Given the following DNA sequence of the template (i.e. noncoding) strand for a given gene: 5'ATTGGCTGTTAGAGCGGCCGTCTAAACATCGTTGGA3' Part A) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends) Part B) Use the genetic code to write the peptide sequence translated in a cell from the mRNA synthesized in part A. Please use the 3 letter abbreviation for each amino acid.
Identify whether each of the following descriptions applies to typical prokaryotic genomes only, typical eukaryotic genomes only, both, or neither, according to lecture. Answer options may be used more than once or not at all. Composed of double-stranded DNA only. Each chromosome has a centromere. Species with larger genomes have more genes. [Choose ] [Choose ] prokaryotes only neither eukaryotes or prokaryotes eukaryotes only both prokaryotes and eukaryotes [Choose ]
The sequence below shows a mRNA sequence derived from a template strand of a DNA molecule: DNA sequence 1: CTTTTTTGCCAT DNA sequence 2: ACATCAATAACT DNA sequence 3: TACAAGGGTTCT Determine the mRNA sequence that you would derive from transcription of each strand Using the genetic code table, show the amino acid sequence that will be encoded by these mRNAs For the 3 DNA sequence, what will be the sequence of the complementary base after the process of replication?
The double-stranded DNA sequence for a bacteria is shown below and it's coding for a hypothetical protein. The strand on top reads 5' to 3' left to right, while the strand on the bottom reads 5' to 3' right to left. The nucleotides are numbered 1 to 100. REMINDER: For this problem, transcription begins with and includes the red and underlined C/G (top strand/bottom strand) base pair and RNA polymerase proceeds from left to right along the DNA. 1 20 40 5'-GTGTCCGTCTAAТАТTGTGAGATGTTAТАТСССGCCGTCAACАCСАТСАА-3' ---- +---------+ 3'-CACAGGCAGATTATAACACTCTACAATATAGGGCGGCAGTTGTGGTAGTT-5' 60 80 100 5'-ACAGGATAATCGCCTGCTGGGGCAAAGGCGGTGAAGGTAAAGGTGTTGCC-3' -+------- -------+ 3'-TGTCCTАТТAGCGGACGACCCCGTTТСCGCCACTТССАТТТССАСААCGG-5 ' 1. What are the nucleotides of the resulting mRNA? Indicate the 5' and 3' ends of the mRNA. 2. What are the amino acids translated from the resulting mRNA? 3. Do the underlined nucleotides TAA (indicated in blue) encode a stop codon for the protein? Briefly explain…