Which example is describing a "nonsense" mutation? O The normal amino acid sequence of a protein is Met-Ala-Phe-Tyr and the mutated allele produces an amino acid sequence Met-Ala-Phe-Leu O The normal amino acid sequence of a protein is Met-Ala Phe-Tyr and the mutated allele produces an amino acid sequence Met-Ala Phe-Tyr O The normal amino acid sequence of a protein is Met-Ala-Phe-Tyr and the mutated allele produces an amino acid sequence Met-Ala-STOP Movirg to the next question prevents changes to this

Which example is describing a "nonsense" mutation? O The normal amino acid sequence of a protein is Met-Ala-Phe-Tyr and the mutated allele produces an amino acid sequence Met-Ala-Phe-Leu O The normal amino acid sequence of a protein is Met-Ala Phe-Tyr and the mutated allele produces an amino acid sequence Met-Ala Phe-Tyr O The normal amino acid sequence of a protein is Met-Ala-Phe-Tyr and the mutated allele produces an amino acid sequence Met-Ala-STOP Movirg to the next question prevents changes to this

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Similar questions

43 For the amino acid sequence shown, could more than one sequence of bases in MESSENGER RNA encode this peptide? MET-PRO-LYS-GLY SER Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a YES NO Unanswered Save 44 A mutation that changes the amino acid sequence in a protein sometimes increases the fitness of the individual. Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a TRUE FALSE
G T-A what's called a FRAMESHIFT mutation, meaning the reading "frame" čhanging the amino acid sequence from this point forward G-Cc A-u SUBSTITUTION (one base is substituted for another) --- If a substitution changes the amino acid, it's called a MISSENSE mutation --- If a substitution does not change the amino acid, it's called a SILENT mutation --- If a substitution changes the amino acid to a "stop." it's called a NONSENSE mutation Complete the boxes below. Classify each as Deletion, Insertion or Substitution AND as either frameshift, missense, silent or nonsense (Hint: Deletion & Insertion will always be frameshif Original DNA Sequence: TACA C C T T G G C G A CGAC T ... MRNA Sequence: Au GduGilAAdk GcuadiGA stait -TrP Pen-frg-cys stop Amino Acid Sequence: Mutated DNA Sequence #1 TA C»A(T C•T T G•G C GªA C G' A C T.. What's the mRNA sequence? AUGOUTAGOAAC•CECOUGIC•UEIA amino acid sequence? Will there likely be effects? yes (Circle th metootop What type of mutation is this? NONSense…
Gene editing is also used to explore the structure and function ofproteins. For example, changes can be made to the coding sequenceof a gene to determine how alterations in the amino acid sequenceaffect the function of a protein. Let’s suppose that you areinterested in the functional importance of a particular glutamicacid (an amino acid) within a protein you are studying. By geneediting, you make mutant proteins in which the glutamic acidcodon has been changed to other codons. You then test the encodedmutant proteins for functionality. The results are as follows: FunctionalityNormal protein 100%Mutant proteins containingTyrosine 5%Phenylalanine 3%Aspartic acid 94%Glycine 4%From these results, what would you conclude about the…
Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' Using the one letter code for Amino Acids, what is the predicted AA sequence of the shortest ORF (from N to C-terminal end)? Using the one letter code for Amino Acids, what is the predicted AA sequence of the longest ORF (from N to C-terminal end)?
Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.
Which amino acid sequence will be generated? 5'-GAAUGUCUUCGUUAUUGAUGUAGAA-3'
-Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG -If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTT
Suppose that there is an unknown protein that underwent Edman sequencing method. From N- terminal determination, a biochemist found out that there are two N-terminal amino acid residues, V and G. What is the original sequence of the protein given the following peptide fragments: after digestion with Chymotrypsin: G-L-S-R-G-M-w V-A-L-F Q-L-Y L-R-V-W G-M-V-E-A-D-I-P K-S-P-E-M-T-W R-M-A-S-E-K-P-G-H after digestion with Trypsin: P-G-H V-W-G-M-V-E-A-D-I-P M-A-S-E-K G-M-W-Q-L-Y-L-R S-P-E-M-T-W-R G-L-S-R V-A-L-F-K after digestion with Cyanogen Bromide: T-W-R-M W-Q-L-Y-L-R-V-W-G-M V-E-A-D-I-P A-S-E-K-P-G-H V-A-L-F-K-S-P-E-M G-L-S-R-G-M
A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 5: Met-Ser-Pro-Arg-Leu-Leu-Glu-Gly
A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 2: Met-Ser-Pro
A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. For each mutant, indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 1: Met-Ser-Ser-Arg-Leu-Glu-Gly b. Mutant 2: Met-Ser-Pro c. Mutant 3: Met-Ser-Pro-Asp-Trp-Arg-Asp-Lys d. Mutant 4: Met-Ser-Pro-Glu-Gly e. Mutant 5: Met-Ser-Pro-Arg-Leu-Leu-Glu-Gly
Compare the two DNA sequences shown below and consider the single nucleotide mutation made In the lower DNA sequence (shown in bold font). This is an example of a mutation. DNA: АTG CGC TСС САТ СТТ ААС AAА GAG GTT GGC ТАТ ТТТ Protein: Met-Arg-Ser-His-Leu-Asn-Lys-Glu-Ala-Gly-Tyr-Phe DNA: ATG CGC TCC CAT CTT AAC CAA AGA GGT TGG CTA TTT T Protein: Met-Arg-Ser-His-Leu-Asn-Gln-Arg-Gly-Trp-Leu-Phe- missense nonsense antisense O frame-shift silent