What is the advantage, if any, of direct development in gnathostomulids? 2. What are the implications of the reproductive strategies of rotifers in their survival?
Q: differences between three domain and five kingdom schemes of biological classification.
A: Introduction Taxonomy is the science of identifying, categorizing, and describing groupings of…
Q: SILICOSIS CAN OCCUR BY INHALATION 1. dust containing free silica 2. coal dust 3. asbestos dust 4.…
A: Side effects of silicosis generally show up after numerous long periods of exposure. In beginning…
Q: You are walking to class, pondering the intricacies of physiology, when you trip over an uneven…
A: The largest part of the brain is cerebrum. It is divided into two hemispheres, or halves, called the…
Q: To examine: Whether the statement, “The three respiratory enzyme complexes in the mitochondrial…
A: The mitochondria is a double-membraned structure found in both plant and animal cells. The structure…
Q: Fetuses whose cells are triploid, that is, contain three full sets of chromosomes, develop to term…
A: INTRODUCTION The DNA molecule is packed into thread-like structures called chromosomes in the…
Q: Ray-finned fish Rodents & rabbits Crocodiles Birds Sharks Amphibians Primates Hair Eggs with shelle…
A: The phylogeny tree is given in the image. It depicts the relationship between the taxons present in…
Q: 1. What are the major adaptations that allow nemertines to thrive in the marine environment? Support…
A: Adaptation: It is a process of evolution that allows any particular organism to be well suited for…
Q: Which of the following would NOT leac protein denaturation? A. A pH change B. A covalent compound C.…
A: In biology, denaturation is the modification of a protein's molecular structure. Many of the weak…
Q: Write the characteristics of the seven taxonomic hierarchy in sentences/ paragraph and their…
A: Please follow step 2 for detailed explanation.
Q: discoideum) occasionally aggregate into a colony. About 20 percent of the amoebae in the colony make…
A: Kin selection favors the reproductive success of the other relatives even at a cost to the…
Q: Gregor Mendel: CHECK ALL THAT APPLY conducted research that proved that the "blending hypothesis"…
A: Introduction Gregor Mendel:- He was an Austrian scientist, teacher, and Augustinian prelate who…
Q: If the base sequence of template strand reads GCCATTAC, what is the base sequence of the mRNA? O A)…
A:
Q: Can you determine if a plant is a monocot or dicot just by looking at the pattern of the roots? The…
A: Introduction In vascular plants, a vascular bundle is a constituent of the transport system. The…
Q: Ancient Greece and ancient Rome tried to conserve energy in all of the following ways except: A.…
A: In the shadow of the emergence of human civilization and urban settlements, the history of Ancient…
Q: What type of transporter moves glucose into the cell against its concentration gradient? A.…
A: The plasma membrane of the organism is a selectively permeable one which only allows restricted…
Q: Recommendations for a healthy diet suggest which of the following energy distributions? A.…
A: Introduction Carbohydrates, lipids, and proteins are macronutrients that must be consumed in large…
Q: What adaptations do plants have to meet these environmental challenges?
A:
Q: HIV can be treated with therapy, but there is a growing in the level of innate immune activation…
A: Inanate immune system constitute first line of defense to HIV virus, paatern of association is the…
Q: Explain in 2 sentences why Evolution walks a perilous tightrope between continuing and ending.
A: 1. Evolutionary biology is the study of history of different life forms on this planet. Evolution is…
Q: In phloem, organic compounds flow through ______ .a. collenchyma cells c. vesselsb. sieve elements…
A: Organic compounds are the compounds that are a build-up of carbon and hydrogen. In plants, phloem…
Q: Dekaylen umber of human diseases result from chromosomal abnormalities. Individuals with cri du chat…
A: Cri-du-chat syndrome, often called 5p- (five p minus) syndrome, is a chromosomal disorder caused by…
Q: ch of the following is NOT a feature associated with bipedalism? e legs are longer than the arms. e…
A: Before the evolution of bipedalism individual walked on the four legs this was called…
Q: Which of the following would be an adequate stimulus for a chemoreceptor? oxygen photon…
A: The chemoreceptors are nerve cells or receptors that sense changes in the substance composition of…
Q: The sodium pump is an example of a catabolic process. an anabolic process. stored energy. a. b. C.…
A: The sodium-potassium pump is an example of an active transport membrane protein/transmembrane…
Q: What physical activity that can change the gas concentration and how to restore and maintain to…
A: Human body maintains the homeostasis in many ways. This homeostasis of gases can be maintained by…
Q: II. Problem Solving: Instruction: Using the data on the situation below, compute for the…
A: We are only allowed to do upto three subpart of a question. Please repost the undone question again.…
Q: DISCUSS PROCEDURES AND METHODS LABORATORY PROCEDURES PROCEDURES AND METHODS Doudenal material…
A: Introduction A complete blood count (CBC) is the most common blood test performed. The CBC is a test…
Q: Part A: A wild-type fruit fly with a smooth body, straight wings, red eyes and paired antennae (br+,…
A: Answer given in step 2. Please find the attached immage. Thank you.
Q: What did Enterobacter aerogenes to do with the Lactose negative go to the Serratia liquefaciens?…
A: Enterobacter aerogenes is a gram negative rod shaped bacteria that causes several infections in the…
Q: It has been established that V. parahaemolyticus cross-reacts with many marine bacteria…
A: Serological tests signify those tests, that detect the antibodies against a microorganism. It…
Q: GENERAL BIOLOGY 2 Q1 : How can plants reproduce naturally?? A. Using anthers B. Using cuttings C.…
A: plants reproduce naturally by Using runners.…
Q: For the number 7.31000 Convert the number to Scientific Notation. If you add1 to the last position…
A: Given number is 7.31000 To do= add 1 in the last position and convert it into scientific notation.
Q: Based on the fish dissection, describe the structure of skull and vertebral column design. How does…
A: Answer
Q: What does the negative of the Methyl Red for the Enterobacter aerogenes to do
A: The methyl red (MR) test identifies the formation of enough acid during glucose fermentation and the…
Q: Why are bacteria and archaea classified into different domains
A: Archaea and bacteria are prokaryotic organisms but are placed in the different domains because they…
Q: Where are proteins for export produced? A. Golgi apparatus B. Rough endoplasmic reticulum C.…
A: Proteins are the macromolecules ; which are made up of amino acids.These proteins play very…
Q: Which of the following organisms practice internal fertilization and external development. Chickens,…
A: Introduction :- Internal fertilisation is the joining of an egg and sperm cell inside the female…
Q: Based on the past activities about constructing of phylogenetic trees, how do you distinguish…
A: When the evolution of different organisms or species from a common ancestor is depicted through a…
Q: Suppose you had a method of cutting DNA at specific sequences of nucleotides. how many nucleotides…
A: DNA (deoxyribonucleic acid) is the hereditary material in humans and almost all other organisms.…
Q: vascular cylinder, vascular bundle, ground tissue, epidermis , palisade mesophyll, spongy mesophyll,…
A:
Q: Endosymbiosis states that free-living [ ? ] were engulfed J of and became the [ ]of the eukaryotes…
A: Introduction :- Endosymbiosis occurs when one cell engulfs another, resulting in a coevolved…
Q: Exponential Decay A. Dehydration Biological Half-Life: "The time required for half the quantity of a…
A: Dehydration simply refers to the removal of water content from the raw material. The rate of…
Q: DNA Sequence Enter DNA sequence below Original sequence ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG…
A: DNA contains the genetic information about the characteristics features of te organism present in…
Q: Describe the four membranes in the avian egg. How does EACH membrane affect the developing embryo?
A: Avian egg development.
Q: How large (as a proportion of body size) should the testes of chimpanzee males be relative to…
A: The testicles are responsible for making testosterone, the essential male sex hormone, and for sperm…
Q: How could you prove that the Tn5 insertion was in the lac operon?
A: Genetic engineering (GE) is the intentional change of an organism's genetic structure, which…
Q: A black mare is crossed to a chestnut stallion and a bay colored son and a bay colored daughter are…
A: Answer given in step 2 onwards. Please find attachment. Thank you
Q: If your 16x concentrated stock solution contains 20g of Nacl per liter, how much NaCI would one…
A:
Q: Venous System a. How does the blood in the pulmonary vein differ from that in other veins? b. Name…
A: All vertebrates' circulatory systems are dominated by veins and arteries. With each heartbeat, they…
Q: Question 6 All of the following are functions of water except? O Acts as a coenzyme in chemical…
A: Water isn't just for quenching your thirst; it's also necessary for keeping your body running…
1. What is the advantage, if any, of direct development in gnathostomulids?
2. What are the implications of the reproductive strategies of rotifers in their survival?
Step by step
Solved in 4 steps
- 1. What are the characteristics of acanthocephalans that support their parasitic nature? Cite examples. 2. What is the advantage, if any, of direct development in gnathostomulids?1. What are the implications of the reproductive strategies of rotifers in their survival? 2. What are the major adaptations that allow nemertines to thrive in the marine environment? Support your answer.The first juvenile larva of Ascaris is known as- (A) Filiform larva (B) Rhabditiform larva (C) Miracidium larva (D) Microfilariae
- 1. How do the larval forms of the trematodes and the cestodes differ? 2. How do their life cycles differ?1. State the function of the following parts of the genus Romalea (grasshopper): antenna, tympanum, spiracles, ovipositor (female), gastric caeca, malphigian tubules, tracheae, air sacs What are the hairlike appendages called that anchor into the skin of annelids? What structures do earthworms have to help dispose of nitrogenous wastes? Briefly describe how earthworms reproduce and what structures are involved.1. Indicate the Phylum, Class, Order, Family, Genus and the species name of any one grasshopperof agricultural importance. 2. What is the difference between a swarm and a hopper band? 3. What is the evolutionary significance of parthenogenesis in the Class Insecta? 4. What is the scientific name of the locust causing havoc currently in the horn of Africa? 5. How does paurometabolous metamorphosis differ from hemimetabolous metamorphosis?
- 1. What would you say is the most important function or role of arthropods and why? 2. What are the major similarities and differences between parasitic and free-living nematodes?1. Among the phylum porifera, Cnidaria, platyhelminthes, annelids, mollusca, Nematoda, Arthropoda, echinodermata, and chordate, what animal phylum undergo ecdysis?1. How are the lifestyle (free – living vs parasitic) related to the morphology of the annelids? 2. What are the different adaptations of phylum Annelida in different habitat?
- 2. Differentiate between the rhabditiform and filariform of Ancylostoma, Necator and Trichostrongylus. 3. Why do we have to use special techniques for the recovery of pinworm eggs?1. Classify jellyfish and ant based on the following characteristics: d) Mechanism of coelom formation, if coelomate e) the origin of mouth? f) symmetry of cleavage? g) cleavage pattern, determinate or indeterminate? h) protostome or deuterostome?1. Why do megapodiidae have an incubating egg and what does it do? 2. How does being non-migratory affect galliforms' anatomy and physiology? 3. What is crop milk and when is it produced? 4. What are apteria? Do penguins possess them?