what is balanced chemical equation for the oxidation of benzoin to benzil using sodium hypochlorite
Q: Construct the two enantiomeric forms/structure of the following monosaccharides and designate the…
A: Monosaccharides are simple sugars, the basic units of carbohydrates. There are two types of…
Q: Alternative splicing: Question 15 options: results from non-spliceosome mediated splicing. is…
A: One notable difference between prokaryotic genes and eukaryotic genes is that prokaryotic genes do…
Q: 10. A new protein of unknown structure has been purified. Gel filtration chromatography reveals that…
A: From the given data, we can deduce the following about the protein's tertiary and quaternary…
Q: miRNA is distinct from siRNA solely because: Question 9 options: miRNA is always an imperfect…
A: mRNA, tRNA and rRNA are the types of RNA that participate in gene expression. miRNA or micro RNA and…
Q: 5'-AATGCCTCAGCCGATCTGCCTCGAGTCAATCGA TGCTGGTAACTTGGGGTATAAAGCTTACCCATGGTATCGTAG…
A: PCR is a lab technique used for amplification of target DNA sequence by using a thermostable DNA…
Q: H НО С CH₂OH I 5C 0-I H ОН | H -0, Н I-о- 2С ОН a-glucose 1C H ОН
A: If the OH group is placed below the ring on the anomeric carbon or first carbon of the cyclic ring…
Q: Consider the following compounds. Sablabla CH3 H₂C H₂C CH3 2 3 Use the numbers shown to answer the…
A: Organic reactions can be defined as the reactions in which organic reactants react with each other…
Q: ACTIVITY 10.7.1 Complete the table below for the gluconeogenesis with their corresponding precursor…
A: The metabolic process in the liver called "gluconeogenesis" creates glucose from precursors that are…
Q: Which of the following statements is most accurate ? All statements are accurate All prescribed…
A: The objective of the question is to identify the most accurate statement among the given options…
Q: 2. Draw the ringed form of D-glucose with the following modifications: (a) Convert to sugar acid at…
A: Below answer given Explanation:Step 1:(A) Step 2:(B)(C)&(D) Step 3: Step 4:
Q: Binding of a ligand to protein X affects the binding properties of another site on X. This is an…
A: An enzyme is defined as a biological catalyst or simply a molecule that is typically always a…
Q: 7. Do Km and Vmax get affected by available substrate concentration? Explain.
A: Enzymes are high molecular-weight protein molecules that catalyse biochemical reactions. The…
Q: A glucose molecule with its 3rd carbon radiolabelled underwent glycolysis. Which carbon atom in the…
A: During the process of glycolysis, glucose is broken down into pyruvate and energy, producing two…
Q: 8. Draw the product(s) for the following biosynthetic reactions catalyzed by enzyme listed below the…
A: 1.2.3.4.5.
Q: QUESTION 1 You have a crude lysate sample (CL) containing a mixture of six proteins (1, 2, 3, 4, 5,…
A: Proteins fold in a way where the hydrophobic residues are sequestered towards the interior of the…
Q: 4. RNA hydrolysis As discussed in class, we can predict how much of RNA we expect to be in a…
A: RNA can undergo slow, nonenzymatic, spontaneous hydrolysis, due to the presence of 2'OH in its…
Q: In a tabular form list two differences between heat shock and electroporation as methods of…
A: Transformation is the process by which a cell takes in naked DNA from its environment. Heak shock…
Q: 1. Base-pairing. In DNA, A bonds with T and G bonds with C through hydrogen bonds. Hydrogen bonds…
A: Hydrogen bonds are formed between a hydrogen bond donor and a hydrogen bond acceptor.Hydrogen bond…
Q: Some enzymes have catalytic activity only limited by diffusion. Which rate constants of an enzyme-…
A: Diffusion is the process by which molecules move from an area of higher concentration to an area of…
Q: 1. What is the isoelectric point of tyrosine? Draw out the different structures of tyrosine at each…
A: **Since you have posted multiple questions, we will provide the solution only to the first question…
Q: Draw the reaction between sphingosine and arachidonic acid and draw the full structures
A: Sphigosine is the platform molecule of sphingolipids. Arachindonic acid is a 20 carbon fatty acid…
Q: Consider the malate dehydrogenase reaction from the citric acid cycle. Given the listed…
A: The free energy change for the malate dehydrogenase reaction of the TCA cycle is ≈21.122…
Q: 9. Lactose exists in two anomeric forms, Draw both anomeric forms of lactose. Why no anomeric forms…
A: Answer is as follows lactose and sucrose both are the forms of sugar.Lactose form 2 anomeric…
Q: how does the protein porin cross the lipid bilayer in a cell membrane
A: The objective of this question is to understand the mechanism by which the protein porin crosses the…
Q: What category of biomolecule would the following structure be associated with: 0= HO HO OH OH 애애 OH…
A: The structure of the molecule is given - It is a polyhydroxy keto compound having condensed…
Q: Draw the major organic product for the following reaction. 1. LiAlH ཝ་རི་-w;"", - CH3-C C-CH 2.
A: The reaction is an example of reduction reaction where both the functional group reduces into the…
Q: A) H H₂N-C-C <=0 CH2 OH ОН н D) H2N-C-C <=0 CH2 OH HO CH3 B) H₂N-C H3C-CH CH2 CH3 0= OH E) H2N-c-c С…
A: Amino acids are simply an alpha-carbon bonded to 4 different groups. The 4 groups are;an alpha-amino…
Q: 2) You are studying the tripeptide Lys-Val-Thr. a) Draw the full structure of the tripeptide…
A: Pepetides are composed of amino acids. Amino acids are biomolecules where a carbon atom (called…
Q: ANSWER A AND B PLS
A: To determine the Vmax and Km in the absence ofinhibitors, we can use the Michaelis-Menten equation,…
Q: H-Bond donors PSA 1532 55 140 60 75 Which of the following compounds is more likely to be a…
A: Compound AExplanation:Of the four compounds listed, compound A is most likely to be a substrate for…
Q: Question 1: tRNA and amino acyl tRNA synthetases Part g: What chemical and structural characters are…
A: Part g: There are several chemical and structural similarities between the amino acids Ile…
Q: In the following graph, enter the number of the curve that corresponds to each of the following…
A: Enzyme inhibition occurs when certain substances also called inhibitors, bind to and inactivate…
Q: The 5’ cap is involved in all the following except: Question 19 options: Splicing exons…
A: The processing of mRNA formed from transcription is called post transcriptional modification. Thes…
Q: One strand of a double-helical DNA has the sequence 5'-GCGCAATATTTCTCAAAATATTGCGC-3'. Write the base…
A: According to Watson-Crick base pairing rule, adenine (A) pairs with thymine (T) while guanine (G)…
Q: You are told to analyze the purity of your product with TLC. Which of the following TLC plates would…
A: The working principle of thin-layer chromatography is the same as column chromatography. A small…
Q: From the chart below, comment on the effect of substrate concentration on the rate of reaction.
A: Here we are using 10 tubes. A specific substrate concentration is used in two tubes each. For…
Q: p53 is an activator of a miRNA called miR-145. miR-145 targets c-myc, a gene that promotes cellular…
A: Increased proliferation and survival.Explanation:Increased proliferation and survival would be the…
Q: 2. The mature form of TEM-1 ß-lactamase, an enzyme of 290 amino acid residues that hydrolyzes…
A: Before calculating the isoelectric point (pI) of the enzyme, we need to be thorough with the…
Q: Studying mis-splicing events on a cell-wide basis (i.e., all mis-splicing events in a cell type) can…
A: Studying mis-splicing events on a cell-wide basis (i.e., all mis-splicing events in a cell type) can…
Q: In an a helix, how does bonding occur between the amino acids in the polypeptide chain? Match the…
A: An amino acid is a biomolecule made up of a hydrogen atom, an amino group, a carboxyl group and a…
Q: 1. H₂N a. Draw the peptide sequence, including stereochemistry (wedges and dashes) for Glu-Cys- Gly.…
A: Stereochemistry refers to the illustration of the arrangement or connectivity of atoms to a chiral…
Q: Ringlemann scale is used to analyze O a. Carbon monoxide Ob. Nitrogen dioxide O c. hydrocarbons O d.…
A: The objective of the question is to identify the substance that the Ringlemann scale is used to…
Q: Problem 1
A: The objective of this question is to identify the non-recombinant mice from a cross between FG/fg…
Q: Genetics Question 5
A: The objective of the question is to identify the correct event that occurs during the Anaphase of…
Q: 2. Peter does not tolerate lactose in milk. He bought a solution of ẞ-galactosidase where [Eo]=10.0…
A: To determine the initial rate of reaction (Vo) Vo = Vmax [C]KM +[C]…
Q: STEM Workplace Practices Q7
A: The objective of the question is to identify the primary responsibilities that are routinely…
Q: You have a crude lysate sample (CL) containing a mixture of six proteins (1, 2, 3, 4, 5, B-…
A: Proteins precipitate at specific concentrations of various salts. The concentration of salt required…
Q: The enzyme ẞ-methylaspartase catalyzes the deamination of ẞ-methylaspartate: CH, NH, OOC-CH-CH-COO…
A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: (c) The tube and cylinder diagram to the right illus- trates schematically the potassium channel…
A: answers are given below.Explanation:c) the positioning of Tyr62 and Thr74 on the Alpha helix is…
Q: Directions: Answer the following as directed: vinu oto de 00 200nsko2 brs 2nA lo epello 1. After…
A: Amino acids are building blocks of proteins, which have three different chemical groups: an amino…
what is balanced chemical equation for the oxidation of benzoin to benzil using sodium hypochlorite
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- The conversion of glutamate to alpha-ketoglutarate is an example of oxidative deamination. Give the complete chemical equation of the said pathway. What happens to the second product of this reaction?Write balanced equations for each of the reactions of thecitric acid cycle.When grown anaerobically on glucose, yeast (S. cerevisiae) converts pyruvate to acetaldehyde, then reduces acetaldehyde to Pethanol using electrons from NADH. Write the chemical equation for the reaction that reduces acetaldehyde (CH3CHO) to ethanol (CH3CH2OH). The table provides the standard reduction potential, E', of the relevant half-reactions. Half-reaction Acetaldehyde + 2 H+ + 2e¯ → ethanol NAD+ + 2H+ + 2e¯ → NADH + H+ E'° (V) -.197 -.320 Calculate the equilibrium constant, K'eq, at 25.0 °C for the reaction that reduces acetaldehyde to ethanol. K'e ×10 = eq
- In some brain cancer cells, a mutated form of isocitrate dehydrogenase, instead of catalyzing the oxidation of the secondary alcohol of isocitrate, catalyzes the reduction of a-ketoglutarate. Draw the product of the reaction.HEPES, 4-(2-hydro)-1-piperazine ethane sulfonic acid, shown below. fully protonated, has pKa’s of 3.00 and 7.55. It is a commonly used buffer for tissue culture and organ storage during transplantation due in part to its effectiveness over a wide temperature range. One-way oxalic acid can be produced in fungi by hydrolysis of oxaloacetate, an intermediate in the Kreb’s citric acid cycle, to produce oxalic acid and acetic acid. This reaction, shown below, is catalyzed by oxaloacetase. [O2CC(O)CH2CO2] 2− + H2O → C2O44−+ CH3COO− + H+ oxaloacetate oxalic acid acetate In a 1-ml reaction mixture containing 50 mM NaCl, 50 mM HEPES, pH 7.8, 5 mM oxaloacetate and 5 pmol oxaloacetase, complete hydrolysis of the oxaloacetate was achieved in 10 minutes of incubation at 30°C. What was the pH of the reaction mixture at the end of the reaction?Triosephosphate isomerase (TIM) catalyzes the conversion of dihydroxyacetone phosphate to glyceraldehyde-3-phosphate. The enzyme’s catalytic groups are Glu 165 and His 95. In the first step of the reaction, these catalytic groups function as a general-base and a general-acid catalyst, respectively. Propose a mechanism for the reaction.
- With regard to the glyceraldehyde-3-phosphate dehydrogenase enzyme reaction: The product of this reaction is “rather special”. CommentConsumption of nitrate-rich vegetables such as spinach have been shown to reduce blood pressure in prehypertensive individuals (i.e., those having no history of clinical hypertension), a phenomenon attributed to increased nitric oxide synthesis. Describe the reactions that convert nitrate (NO3 −) to nitric oxide (NO•) in the body.Write a balanced equation for the conversion of stearate into acetoacetate.
- What is the catalytic triad on chymotrypsin? Detail its importance.What residues mediate zinc binding in carbonic anhydrase and what role does zinc play in catalysisThe following phenylboronate is a competitive inhibitor of a chymotrypsin-like enzyme. Unlike carbon, boron is quite happy to be bonded to three oxygens (and one carbon)—explain why this feature makes it a much better inhibitor than the corresponding carboxylic acid (which is quite ineffective).