The trp operon is: **(for additional information review the CogBooks Module, answer explained on CogBooks): In the absence of tryptophan, the trp repressor dissociates from the operator, and RNA synthesis proceeds. promoter operator trpE trpD trpC trpB trpA RNA polymerase repressor When tryptophan is present, the trp repressor binds the operator, and RNA synthesis is blocked. promoter operator trpE trpD trpC trpB trpA RNA polymerase repressor tryptophan

The trp operon is: **(for additional information review the CogBooks Module, answer explained on CogBooks): In the absence of tryptophan, the trp repressor dissociates from the operator, and RNA synthesis proceeds. promoter operator trpE trpD trpC trpB trpA RNA polymerase repressor When tryptophan is present, the trp repressor binds the operator, and RNA synthesis is blocked. promoter operator trpE trpD trpC trpB trpA RNA polymerase repressor tryptophan

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

When referring to attenuation in the regulation of the trp operon it would be safe to say that, when there are high levels of tryptophan available to the organism, ________. tryptophan inactivates the repressor protein translation termination of the trp operon is likely the trp operon is transcribed at relatively high levels the ribosomes stall during translation of the attenuator region transcription termination at the attenuator region is likely
Trp operon of E. coli is an inducible sytem since it turns on in the presence of tryptophan. In most bacteria, protein synthesis is initiated with a modified methionine residue (N-formylmethionine), whereas unmodified methionines initiate protein synthesis in eukaryotes. Both DNA replication and transcription follow a 5’ to 3’ direction of polarity. Write T if the statement is true and write F if the statement is false
Regarding the trp operon: when levels of tryptophan are low, the ___ hairpin forms, resulting in _____ of transcription. Group of answer choices 2-3; termination 3-4; termination 3-4; continuation 2-3; continuation
The following is a sequence of the leader region ofthe his operon mRNA in Salmonella typhimurium.What bases in this sequence could cause a ribosometo pause when histidine is limiting (that is, when thereis very little of it) in the medium?5′ AUGACACGCGUUCAAUUUAAACACCACCAUCAUCACCAUCAUCCUGACUAGUCUUUCAGGC 3′
Consider this strain of E. coli with lac operon alleles: IS pt o* z* y+ /T p* oCz- Y+ In a written response, briefly explain if beta-galactosidase AND permease will be expressed, and if so, will they be inducible or constitutive.
Complete the table below by choosing a term(s) in Column B that associates with the term in Column A. Column A Column B Associated terms Repressor Activator Repressor & Operator RNA polymerase Corepressor RNA polymerase & Operon Promoter Operon & CRP LacZ CRP & Inducer Allolactose Inducer & Tryptophan Operator Tryptophan & B-galactosidase CAMP B-galactosidase & CRP binding site
Regarding the tryptophan operon in bacteria, in the presence of tryptophan, tryptophan binds to the Group of answer choices Operon Operator Repressor Promoter RNA polymerase
In the presence of tryptophan and the promoter sequence was mutated such that the RNA polymerase can no longer bind, the structural genes will:[ Select ] ["No longer be expressed", "Be constantly expressed", "Be deleted from the operon"] In the absence of tryptophan and the trpR repressor gene is mutated such that the repressor protein product can no longer bind to the operator, the structural genes will:[ Select ] ["No longer be expressed", "Be constantly expressed", "Be deleted from the operon"] In the presence of tryptophan and the trpR repressor gene is mutated such that the repressor protein product can no longer bind to the operator, the structural genes will:[ Select ] ["No longer be expressed", "Be constantly expressed", "Be constantly expressed"]
In the trp operon, if a mutation occurred in the gene for the repressor so that it could bind to the operator even in the absence of tryptophan____________. a) the inducer cannot bind trpO, so operon gene transcription occurs b) the active repressor cannot bind trpO, so operon gene transcription is attenuated c)the active repressor binds tpO, so operon gene transcription is always repressed d) the repressor binds the corepressor, and operon gene transcription occurs.
Given the Table below concerning the lac operon, match the letter with what would be occurring for each scenario. Repressor is bound to the operator, cAMP complex is bound and transcription is prevented. Allolactose is bound to the repressor, cAMP complex is bound, and transcription is prevalent. Allolactose is bound to the repressor, cAMP complex is not assembled, and transcription is slow Repressor is bound to the operator, cAMP complex is not assembled, and transcription is prevented.
Suppose that a new mutation lacIes, ('es' stands for ‘extra-strength’) has been discovered in the lac operon that allows the lac-repressor to bind even to the lacOc operator. Other properties of lacIes repressor remain normal (that is the same as of lacI+). Given this genotype Is P+ Oc Z+ Y- / Ies P+ O+ Z+ Y+ , under which conditions will the gene lacZ be transcribed to produce β-galactosidase and the gene lacY transcribed to produce permease? A) With lactose, β-galactosidase and permease are produced, without lactose they are not produced B) With lactose, β-galactosidase is produced, without lactose it is not; permease is never produced C) β-galactosidase is always produced and permease is never produced D) With lactose, β-galactosidase and permease are produced, without lactose they are also produced E) β-galactosidase is always produced and permease is produced only in the presence of lactose
Select the correct statement about the trp operon: high levels of tryptophan promotes high transcription of CAP O low levels of tryptophan promote transcription of trp operon genes O high levels of tryptophan stall ribosomes to reduce tryptophan synthesis O high levels of tryptophan promote transcription of trp operon genes