Now we will move on to module 3, where we will examine autoradiographs produced from Sanger sequencing the p53 gene from tissue samples from Valerie's children. Determine the sequences based on the following simulated autoradiographs: A I || 1. Wild-type: GT 11 I B. What the sequence of this portion of the wild-type p53 gene? || 3. Sheila: D. What is the sequence of this portion of Sheila's p53 gene? E. Do Justin or Sheila have a mutation in the p53 gene?
Q: What is the function of gills in mushroom. A.Reproduction B.Breathing C.Defense
A: Mushrooms Mushrooms are the major source of nutrients, which has lot of health benefits. Mushrooms…
Q: tch the statement with the type of distribution it describes. Random Sheetweb weavers (spiders)…
A: Spiders are the air-breathing arthropods that have eight legs, chelicerae with fangs generally able…
Q: How would scientists describe the density of a population? O 47 giraffes living on the African…
A: Population density can be defined as the average number of individuals that belong to a population…
Q: What does the water bring in and take out as it flows through the sponge?
A: Introduction The smallest multicellular animals in the kingdom Animalia are all members of the…
Q: What is the function of innate restriction enzymes in bacteria? • All of the answers are correct…
A: Restriction enzymes are responsible for cutting double stranded DNA molecules from the middle by…
Q: Out an outbreak investigation for communicable diseases is key in disease prevention. Examine the…
A: A communicable disease is one that transmits from one person or animal to another. These diseases…
Q: Does Totoaba offer any ecosystem benefits? I know their demise is causing the Vaquita to go extinct…
A: Totoaba: Totoaba is a large marine fish found in the Gulf of California, is well known for its high…
Q: The majority of colon cancers begin with an alteration of which gene below (select one)? A.…
A: During the time of cell division , cell basically undergo splitting process at regular normal…
Q: 7. pane 9. Splee
A:
Q: Alterations in which of the following intracelluar pathways appear to be required for human cell…
A: <!--<SUB-PART>--> (a) <!--<SUMMARY-INTRODUCTION>--> To Determine: If the…
Q: What does water bring in and take out as it flows through a sponge?
A: Introduction The lowest multicellular animals in the kingdom Animalia, the phylum Porifera, are all…
Q: Which "faces" species is equally distantly related to all other species in the phylogenetic tree?…
A: A species is defined as the largest group of organisms in which any two individuals of the…
Q: 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G that is underlined…
A: Note: As per guidelines we can answer one question at a time ask rest questions to get answers.…
Q: If Scott Summers and Jean Grey have another daughter, what are the chances that she will has red…
A: Introduction : Pedigree charts are family trees that show the members of a family who have been…
Q: Which of the following statements concerning glycogen in different tissues is TRUE? a. Liver…
A: <!--<SUB-PART>--> (a) <!--<SUMMARY-INTRODUCTION>--> To Determine: If the…
Q: Regarding the cardiac cycle at resting HR, when in the cycle does ventricular filling occur? How…
A: Introduction: To pump blood around the body, the atria and ventricles periodically contract and…
Q: ℗ cate which diagram shows the following: one daughter nucleus after telophase of mitosis? one…
A: In the diagram number of chromosomes are given. When the chromosomes are paired it is called diploid…
Q: 2. Imprinted genes: A) Provide an example of epigenetic inheritance. B) Often are near…
A: Epigenetic regulation of the genome is an absolute critical facet of organism's development. Gene…
Q: 3. Why does intercellular spaces are absent in sclerenchyma tissues?
A: Tissue is a group of cells. These cells work together to perform specific function.
Q: Which of the following mothers is MOST Likely to have a child with hemolytic disease of the newborn?…
A: Introduction :- An infant or foetus with hemolytic disease of the newborn (HDN) has a blood…
Q: Describe the steps of DNA replication.
A: Introduction: DNA replication means replicating or producing two same replicas of DNA from one…
Q: explain the events of the Krebs Cycle and the Electron Transport Chain.
A: Cellular respiration is an aerobic metabolic pathway by which sugars are metabolized to release…
Q: What factor does not affect biodiversity? a.) urbanization b.) planting native plants c.)…
A: Introduction :- The variety of animals, plants, fungi, and even microorganisms like bacteria that…
Q: Which of the following statements are true? Both plants and animals use hormones to send signals…
A: Introduction The chemical messengers of our body are hormones. They move to tissues or organs…
Q: B C D E E- . What are p53 genotypes of the following tissues (represent the wild-type allele with +…
A: By the help of gel electrophoresis one can determine the genotype. There could be three types of…
Q: 5. Give a simple illustration of a synapse and its components. Trace and discuss the pathway of…
A: There are a few important points : Neurons are the basic structural and functional units of the…
Q: A True OUTSIDE CELL This cell is at rest. False INSIDE CELL E
A: Neurons have the capability of generating and transmitting nerve impulses. The transportation of…
Q: Doug and Virginia wanted to find out if temperature affects the growth of mould on bread. At lunch,…
A: In the earlier times, the growth of moulds on bread is used as inadvertent natural clocks as almost…
Q: You like a wide variety of types of lettuce, so you plant many different varieties in your garden.…
A: The diversity refers to the different kind of variety of organisms present in an area. A wide…
Q: Which is true about O-H bonds? A. They are polar and oxygen is the negative end. B. They are polar…
A: O-H bond contains an oxygen and hydrogen atom and this bond is a single covalent bond that carries a…
Q: The mammalian heart can beat without input from the brain. True Or false?
A: Heart can be myogenic or neurogenic. In myogenic heart, beating rhythm occurs through specialized…
Q: features of adaptation” may influence program design for a given population.
A: What Features of adaptation in animals leads to influence the population?
Q: For a scientific theory to be valid, it must allow you to get the same results each time. obtain new…
A: A scientific theory is a statement that is universally accepted and explains universal facts. The…
Q: 2. If a potted plant is covered with a glass jar, water vapors appear on the wall of glass jar.…
A: Transpiration is the process through which water is evaporated from plant components with stomata,…
Q: What is the advantage to an organism in using aerobic cellular respiration compared to the anaerobic…
A: Cellular respiration is the process by which the biological fuels are oxidised in the presence of an…
Q: The point where separation of the DNA occurs is called the Stranding point True False
A: DNA replication is a biological process through which a single DNA molecule is used to produce two…
Q: 1. Why do meristematic cells have a prominent nucleus and dense cytoplasm but they lack vacuole?
A: Plant cells with the capacity to proliferate and give rise to new cells are known as meristematic…
Q: 14. The table below shows the percentage of Thymine (T) A C search 15% 30% 50% T 20% 60% O G C m…
A: Introduction :- One of the four nucleobases in DNA's nucleic acid, represented by the letters…
Q: The schematic on the right is for which molecular biology method? What information…
A: Please follow steps 2 & 3 for detailed explanation.
Q: The basis of the different blood groups is... A) Different proteins on red blood cell membranes B)…
A: The different blood groups are A , B ,AB and O. They are differentiated on the basis of Antigen…
Q: 3. Give below is the respiration rate of copepods (Oithona similis) exposed to a wide range of…
A: Introduction : The process of respiration is when an organism's cells use oxygen and glucose to…
Q: COP
A:
Q: Investigate the basis for DNA fractionation and alternatives to agarose and why they may be used
A: DNA, or deoxyribonucleic acid, is the hereditary material in humans and almost all other organisms.…
Q: Given the following, the sequence of urine flow in the urinary tract is: i. Renal papilla ii. Major…
A: Human beings have paired kidneys, which are present on the posterior wall of the abdomen.Normal…
Q: This is an example of? a.) fibrous roots b.) tap roots c.) adventitious roots d.) prop roots
A: Fibrous roots are thin and heavily branched roots that arise from bottom of the plant stem.…
Q: 4. In a genetic experiment with fruit-fly Drosophila melanogaster, F1 females resulting from a cross…
A: If the genes are located on the same chromosome then they are classified as linked genes. In this…
Q: Wrestlers often fast and dehydrate to stay in a specific weight class. What abnormal urine values…
A: Urinalysis It is necessary to identify the athlete's state of hydration. To obtain an accurate…
Q: Explain what structures you saw with fluorescence microscopy in lab, and what type of cells we used.
A: Introduction-- A fluorescence microscope is a optical microscope that uses fluorescence and…
Q: Use the following information to answer the next question. Life Cycle of a Pronghorn Antelope…
A: The pronghorn contains deer like body whose tan is reddish brown. *Reproduction is the process of…
Q: The lagging strand of DNA is synthesized Discontinuously in a 3' to 5' direction In both 5' to 3'…
A: Introduction :- A single DNA strand known as the lagging strand is produced in the 5′ - 3′ direction…
can u help with q. 3? Thank you
Step by step
Solved in 2 steps with 2 images
- Cap, EA1, and Sap are all genes/proteins of interest in this study. For each gene, what gene product is encoded and where is the gene (the literal DNA sequence) located physically in the cell? I need help fimiding this in the artticle and answer as short as possible https://www.ncbi.nlm.nih.gov/pmc/articles/PMC106848/this is what i have said about this image so far, what else can be said aswell including the raw count column. " Interpreting the results of an RNA-Seq analysis is pivotal in understanding the underlying genetic mechanisms of diseases such as breast cancer. In this analysis, Figure 1 provides comprehensive data on differentially expressed genes associated with breast cancer. By delving into the provided information, we can gain valuable insights into the molecular landscape of this disease. First focus is on the gene with the highest fold change, EYA4, situated on chromosome 6. With a staggering fold change of 3604.4176, EYA4 exhibits an unprecedented level of overexpression in cancerous cells compared to normal cells. This profound alteration suggests a pivotal role for EYA4 in breast cancer pathogenesis. The log2 fold change of 11.81555 further emphasizes the magnitude of this difference in gene expression. Statistical significance is evident, with an exceptionally low p-value of…Not all inherited traits are determined by nuclear genes (i.e., genes located in the cell nucleus) that are expressed during the life of an individual. In particular, maternal effect genes and mitochondrial DNA are notable exceptions. With these ideas in mind, let’s consider the cloning of a sheep (e.g., Dolly). A. With regard to maternal effect genes, is the phenotype of such a cloned animal determined by the animal that donated the enucleatedegg or by the animal that donated the somatic cell nucleus? Explain.
- Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′You identify a mouse mutant that has hemophilia and is unable to properly clot blood. Your assays reveal that a novel clotting factor is absent from the blood of the mutant mice. You sequence the genome of the mutant mouse and determine that clotting factor proteins normally associated with hemophilia are all wildtype (no mutations), but the coding sequence of the novel protein differs by one amino acid compared to wildtype. When you synthesize the mutant protein in vitro, it has normal blood clotting activity. Your controls using other mutant hemophilia clotting proteins fail to clot blood in this assay. What would you say the mutant protein results in hemophelia?The p53 protein was discovered through its association with SV40 T antigen and assumed initially to be an oncoprotein. a. What is the current consensus as the function of p53 and what evidence caused this change in view? b. How does the effect of mutation in the p53 gene differ from the effect of mutation in the RB gene what is the molecular basis for this difference ?
- What is Transcriptome analysis? In your answer, also explain, what are the steps and primary methods used in Transcriptome analysis, and what are some important applications of Transcriptome analysis.If you wanted to make a mouse model for any of the following human genetic conditions (a–d), indicate which of thefollowing types of mice (i–vi) would be useful to your studies. If more than one answer applies, state which type ofmouse would most successfully mimic the human disease:(i) transgenic mouse overexpressing a normal mouse protein; (ii) transgenic mouse expressing normal amounts of amutant human protein; (iii) transgenic mouse expressing adominant negative form of a protein; (iv) a knockout mouse;(v) a conditional knockout mouse; and (vi) a knockin mousein which the normal allele is replaced with a mutant allelethat is at least partially functional. In all cases, the transgeneor the gene that is knocked out or knocked in is a form of thegene responsible for the disease in question.a. Marfan syndrome (a dominant disease caused byhaploinsufficiency for the FBN1 gene);b. A dominantly inherited autoinflammatory diseasecaused by a hypermorphic missense mutation in thegene PLCG2;c.…In Figure 6-19,a. what do the square/triangular pegs and holesrepresent?b. is the suppressor mutation alone wild type inphenotype?
- If you were to design an experiment to get p53 back into cancer cells, how would you go about that work? How would you direct p53 into the nucleus of cancer cells without directing it to the nucleus of healthy cells? As an overabundance of p53 in healthy cells would cause problems. Could someone in depth answer these questions for me and explain them cellularly.(i) For the chromatogram below, what is the sequence of the template DNA from base 115 to 125? CTGTGTGAAATTGT TA T CCGC T CA CA AT T C CACA CA A CATA CGAGC CGGAAG CA TA A 110 120 130 140 150 160 (ii) An allele of a gene has the following change in it's sequence ATG GTG CÁC CTG ACT CCT GTG GAG AAG TCT compared to the wild type ATG GTG CAC CTG ACT CT GAG GAG AAG TCT With reference to the sequence; there is a codon, resulting in a change from is a mutation in the to which mutation.You have discovered a family with a new genetic form of anemia. The DNA sequences at the 5’ end of the non-template strand of the normal and mutant DNA encoding the alpha subunit of hemoglobin are given below: Normal 5’-ACGTTATGCCGTACTGCCAGCTAACTGCTAAAGAACAATTA…..-3’ Mutant 5’-ACGTTATGCCCGTACTGCCAGCTAACTGCTAAAGAACAATTA….-3’ What are the amino acid sequences of the normal and mutantpolypeptides?