Humans homozygous for the sickle cell allele have sickle cell anemia. A human that is heterozygous for the sickle cell allele is generally protected from both sickle cell anemia and malaria. This is an example of incomplete penetrance. overdominance. multiple allele systems. polygenic inheritance. codominance
Q: Compare the homebased DNA extraction method with the Phenol:Chloroform extraction method.
A: DNA extraction: The process of extraction of DNA from the cell can be done by various methods.…
Q: Which of the following pathways would you expect to be inhibited by drugs that prevent import of…
A: Explanation: Since the import of proteins into the nucleus is part of the TGF-Beta signalling…
Q: Are the similar structures among vertebrate species during embryogenesis homologous structures?…
A: The existence of similar structures in different species is one of the most important pieces of…
Q: "In a beaker containing 6% NaCl, you place a cell which contains 0.9% NaCl. NaCl doesn t cross the…
A: Introduction : Osmosis is a passive process and happens without any use of energy. It involves the…
Q: Discuss the effects of isotonic, hypotonic, and hypertonic environments on red blood cells and plant…
A: Osmosis is the net movement of water across a semipermeable membrane.
Q: QUESTION 1 An armadillo with the genotype Ee is used for a test cross. What is the genotype of the…
A: Explanation: The expression "genotype" alludes to the hereditary cosmetics of a creature; at the…
Q: Possible answers for each: A) Both hormone and a neurotransmitter. B) Hormone. C) Neurotransmitter.…
A: Hormones only work once they "fit" a part of the body. That is, if cells within the target…
Q: Define and give an example of coevolution.
A: Evolution is the process of change in heritable traits of biological organisms over successive…
Q: Question 1 GO describes a phase where cells are "resting", and are essentially outside of the cell…
A: Genes are distinct units of hereditary traits made up of a particular nucleotide sequence in DNA or…
Q: How would you design an experiment to determine whether two populations of snakes are distinct…
A: The most frequently recognised species idea is the biological one. Interbreeding is used to define…
Q: 4. What are some of the limitations of karyotyping? 5. Define trisomy. Define monosomy. 6. Define…
A: Genetics involves inheritance, characteristics, DNA, genes, proteins, and chromosomes. Everyone…
Q: Explain how plants make organic molecules. Include the terms CO2, H2O, photosynthesis, sugar, and…
A: Plant synthesized organic molecule Glucose by using CO2, H2O & sunlight through the process of…
Q: Please answer fast Question #1: Use answers A-L to answer questions 1-6 below. They can be used…
A: Hydrogen bonds are a main characteristic of protein shape. By a usually usual definition, they…
Q: In fruit flies, red eye color (R) is dominant over brown eye color (r). Two red-eyed fruit flies…
A: The offspring of two parents can be different from both parents as new allelic combinations can be…
Q: 1. In 3 sheets of bond paper, draw the mitosis, meiosis 1 and meiosis 2. 2. Fold each sheet into…
A: A cell divides into two genetically identical daughter cells during the process of mitosis. Meiosis…
Q: 6. (top or bottom) Species A, B, C, D, and, E are all extant species (living today, not to be…
A: Note: According to the guidelines, we are answering the first question here. Please repost the other…
Q: Why are convergent traits considered evidence for evolution
A: Convergent evolution is the independently occurring evolution of comparable traits in animals from…
Q: What are the similarities and differences between schistosoma ans taenia solium?
A: Taenia solium An organism that belongs to the group of playtyhelminthe. These organism are mostly…
Q: Which of the following would be the least desirable model species to learn how proteasomes govern…
A: Model species:- model organisms or species are those which can be easily handled and breed well in…
Q: In mice, genes R and T are 30 m.u. apart. If a mouse with genotype Rt/rT is crossed with a mouse…
A: Linked gene When two different gene located on the same chromosome then it is said they are linked.
Q: Why should we expect to find N. fosteri fossils all over the world, given that it first evolved in…
A: Pangea is a supercontinent that was surrounded by a global ocean called Panthalassa. Fossils are…
Q: In his infamous, genetic code-cracking experiment, what did Nirenberg use as a source of translation…
A: Since you have asked multiple questions, we will solve the first question for you. If you want ant…
Q: The anterior pituitary releases tropic hormones. The role of these hormones is ... to receive…
A: Tropic hormones are hormones that have other endocrine glands as their target. Most tropic hormones…
Q: Do peptide bonds get protonated or deprotonated? Explain
A: Peptides are short chains of amino acids that are linked by peptide bonds. Chains of less than 20…
Q: Reduced tailbones and the associated remnant muscles in humans are an example of what type of…
A: Common descent means common ancestory. Various evidences for the same are homologous organs,…
Q: Consider the DNA CAAGGAGCAAGTAGCCAAGA and briefly describe the plasmid to be used and the method for…
A: Explanation: A plasmid is a circular piece of DNA that will be utilized in the process of inserting…
Q: Which of the following statements about convergent evolution is true? (a) It demonstrates how…
A: Evolution means an organism is keep evolving or bettering itself during the course of time. The gene…
Q: Which of the following statements reflect the difference between RNA and DNA? Multiple answers:…
A: Introduction The process through which a gene's information is used to create a functioning gene…
Q: Match the shorter sequence relative to the longer one. Note: Observe Chargaff's rule of base…
A: The DNA or deoxyribonucleic acid is the genetic material in living organisms that is composed of…
Q: xplain how the following affect membrane fluidity: – Level of phospholipid tail saturation – Level…
A: A plasma membrane is a selectively permeable membrane. It is made up of phospholipids, proteins and…
Q: All mammals have tailbones and muscles for moving a tail. Even humans have a reduced tailbone and…
A: Evolution is the gradual progression in the inherited traits of natural populations over many…
Q: Cells that line your intestines are specialized for nutrient absorbtion and are known to possess…
A:
Q: What are the most abundant components of a plant cell walls? How do the components interact, and how…
A: Cell wall The cell wall is a non living , rigid , and the permeable structure surrounding the plasma…
Q: Which eukaryotic initiation factor (elF) brings the initiator tRNA to the ribosome? elF1 1 O elF2…
A: The process by which the mRNA codes for a particular protein is known as Translation.
Q: Assume that short ear lobes in humans are an autosomal dominant trait that exhibits 60% penetrance.…
A: The unit of heritance which carries information from one generation to the next is called genes.…
Q: Write only the class that exhibits the following characteristics
A: All marine creatures perform critical roles in their ecology. Plankton, on the other hand,…
Q: 2 things are wrong with the paragraph below. Write the word or words that would need to be changed…
A: Fermentation pathways are anaerobic pathways. These pathways are either present in anaerobic…
Q: A diploid species has 3 pairs of chromosomes in its somatic cells. In males, the first pair is large…
A: According to the position of centromere present chromosomes can be of different shapes such as…
Q: A Method of Consolidating and Combining EST and mRNA Alignments to a Genome to Enumerate Supported…
A: The total collection of DNA sequences present in a cell makes up the genome. The human genome is…
Q: 1. What did calcium ions do during fertilization in sea urchins?
A: Sea urchins are free-living echinoderms that have venomous, sharp, brittle spines covering them as…
Q: what is RNA World hypothesis? What is RNA? What are the building blocks of RNA
A: The biopolymers, macromolecules, essential to all known forms of life, made up of pentose sugar,…
Q: Being able to repair old cells, build new cells and structures like the mitochondria you need energy…
A: Introduction Any organic, living system that performs as a single entity is referred to as an…
Q: W S Rehpogs are mythical creatures. They are small and not very smart. Rehpogs live on the ground in…
A: Changes in gene frequency in a population can occur due to 4 reasons- Migration Mutation Natural…
Q: In humans, when iodine levels are adequate, abnormally high TSH secretion would likely result in…
A: Hormones are chemical substances that are secreted by various glands inside the body upon receiving…
Q: What is the most likely mode of inheritance? b) If this were a pedigree you did NOT want to…
A: * There are four types of pedigree. They are X linked recessive X linked dominant Y linked…
Q: Why is it important for the sperm in internally fertilizing animals to undergo acrosome reaction at…
A: The fusion of male and female gametes resulting in the formation of deployed zygote. It ultimately…
Q: If you looked at H&E staining of a fungal-infected mouse tongue vs a non-infected mouse tongue,…
A: H& E stands for Hematoxylin and Eosin stain.This stain is used to observe various cellular…
Q: 6. Explain how buffer systems are important in organisms. In the human body, bicarbonate and…
A: pH homeostasis is critical because some enzymes cannot operate if the pH varies from what it should…
Q: One of your classmates performed a gram stain on Pseudomonas aeruginosa and found variable gram…
A: The "cell wall of Gram-positive" bacteria is mostly composed of peptidoglycan layers that form a…
Q: If a polymorphism is found at a low frequency globally, but has a high frequency in a particular…
A: Polymorphism:- it represents the two or more than two variants of a particular DNA sequences or gene…
Humans homozygous for the sickle cell allele have sickle cell anemia. A human that is heterozygous for the sickle cell allele is generally protected from both sickle cell anemia and malaria. This is an example of
- incomplete penetrance.
- overdominance.
- multiple allele systems.
polygenic inheritance.
codominance
Step by step
Solved in 2 steps
- Hemophilia is a sex-linked trait. A person with hemophilia is lacking certain proteins that are necessary for normal blood clotting. Hemophilia is caused by a recessive allele so use "N" for normal and "n" for hemophilia. Since hemophilia is sex-linked, remember a woman will have two alleles (NN or Nn or nn) but a man will have only one allele (N or n). A woman who is heterozygous (a carrier) for hemophilia marries a normal man: a.What are the genotypes of the parents? b.What is the probability that a male offspring will have hemophilia? c. What is the probability of having a hemophiliac female offspring?Recessives Allele, an allele that is fully expressed in the phenotype of a heterozygote. Select one: True FalseHemophilia is an X-linked disorder that affects the body’s ability to create blood clots. The allele for normal blood clotting, XH, is dominant over the allele for hemophilia, Xh. An unaffected daughter from the above cross married a man who does not have hemophilia. Determine the probability of their offspring being A daughter with hemophilia A daughter without hemophilia A son with hemophilia A son without hemophilia Express your answer as a phenotypic ratio. Number: Answer Answer Answer Answer Phenotype: Affected female Unaffected female Affected male Unaffected male
- A gene is composed of two alleles. An allele can be either dominant or recessive. Suppose that a husband and wife, who are both carriers of the sickle-cell anemia allele but do not have the disease, decide to have a child. Because both parents are carriers of the disease, each has one dominant normal-cell allele (S) and one recessive sickle-cell allele (s). Therefore, the genotype of each parent is Ss. Each parent contributes one allele to his or her offspring with each allele being equally likely. Complete parts a) through c) below. a) Genes are always written with the dominant gene first. Therefore, there are two instances the offspring could have genotype Ss (one if the mother contributes the dominant allele and the father contributes the non-dominant allele; and one if the father contributes the dominant allele and the mother contributes the non-dominant allele). List the other two possible genotypes of the offspring. (Use a comma to separate answers as needed.)A couple are both phenotypically normal but their son suffers from hemophilla, a sex linked recessive disorder. What fraction of their children are likely to suffer from hemophilia. what fraction are likely to be carriers.In humans, hemophilia is a sex-linked trait. Females can be normal, carriers, or have the disease. Males will either have the disease or not (but they won’t ever be carriers). X H X H = female, non-hemophilic X H X h = female, carrier X h X h = female, hemophilia X H Y = male, non-hemophilic X h Y= male, hemophiliac a.) Show the cross of a man who has hemophilia with a woman who is a carrier. What is the probability that their children will have the disease? b.) A woman who is a carrier marries a non-hemophilic man. Show the cross. What is the probability that their children will have hemophilia? What sex will a child in the family with hemophilia be? c.) A woman who has hemophilia marries a non-hemophilic man. How many of their children will have hemophilia, and what is their sex?
- PKU disease is recessive. A man and a woman are both carriers for PKU disease. Determine the following: Genotype of the man: Genotype of the woman: Possible genotypes of children: Possible phenotypes of children: Probability of PKU disease in their children:Hemophilia is a blood disorder which is sex-linked. A woman carrier has children with a normal man. Determine the chances for girls and boys with hemophilia. [Remember that females have the XX genotype and males have the XY genotype. Do not place an allele on the Y chromosome. Example: XN Xn for female; Xn Y for male]Hemophilia is an X-linked disorder that affects the body’s ability to create blood clots. The allele for normal blood clotting, XH, is dominant over the allele for hemophilia, Xh.An unaffected female that is not a carrier mated with an affected male. Which of the following rows identifies the possible genotypes of the offspring?
- A woman who has blood type A positive has a daughter who is type O positive and a son who is type B negative. Rh positive is a trait that shows simple dominance over Rh negative and is designated by the alleles R and r, respectively. A third gene for the MN blood group has co dominant alleles M and N. If both children are of blood type M in addition to their ABO blood type, list all of the possible parental phenotypes for the ABO, MN and Rh traits.Sickle cell anemia is a disease that is caused by a mutation in the gene that produces hemoglobin. Hemoglobin carries oxygen in red blood cells. The HbA allele produces normal hemoglobin and the HbS allele produces hemoglobin that sticks together and causes red blood cells to sickle. Heterozygous individuals (HbAHbS) produce both normal and "sickle" hemoglobin so the HbA and HbS alleles are codominant. Heterozygotes do not develop sickle cell anemia and are described as having the sickle cell trait. Individuals that are homozygous for the sickle allele (HbSHbS) only produce "sickle" hemoglobin and develop sickle cell disease. A man with the sickle cell trait married a woman with the sickle cell trait. Determine the probability that they will have children with the sickle cell trait or sickle cell disease.Record your answer as a value between 0 and 1 rounded to two decimal places. AnswerQUESTION 5 For the following pedigree, assume that the mode of inheritance is X-linked dominant, and that the trait has full penetrance and expressivity. I 11 IV 1 2 3 4 1 2 5 6 7 8 HOOD OD FO 1 2 3 4 5 6 7 8 9 1 2 3 4 OOD OC 10 11 12 13 14 15 ☐☐ 5678