DNA Sequence Enter DNA sequence below Original sequence ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG Edited sequence Apply Show DNA Transcribe Translate Show protein Continue one step Start/continue model Stop Reset

Q: Which of the following would be an adequate stimulus for a chemoreceptor?     oxygen     photon…

A: The chemoreceptors are nerve cells or receptors that sense changes in the substance composition of…

Q: What is the function of outer hair cells? How does the function of these cells differ compared to…

A: INTRODUCTION Inner hair cell They are sensory receptors gives acoustic information to brain. Outer…

Q: Explain how human hunting has affected the traits of the African elephants. Explain why being a…

A: Elephants are the largest land mammals on earth and have distinctly massive bodies, large ears, and…

Q: Compare and contrast the views of animal evolution based on body plan characteristics to those based…

A: When the anatomical or physical traits are considered for the determination of evolution then the…

Q: How does natural increase, natural decrease, equilibrium affects or influence the population and…

A: Typically, population refers to the number of people in a certain place, such as a city or town,…

Q: 1. What is the source of maltose? a. Small intestine brush border (microvilli) b. Pancreas c.…

A: Maltose is the disaccharides carbohydrate which is digested by the maltases Secreted by the…

Q: QUESTIONS FOR RESEARCH AND PROBLEMS 1. Give the major factors that cause changes in the genotype and…

A: The complete set of genetic material in an organism is known as genotype. It can also be referred to…

Q: fa restriction endonuclease recognizes and cleaves a linear piece of DNA and Circular DNA at 8…

A: Restriction endonuclease  These are also known as restriction enzymes. These enzymes have been…

Q: What role does each component of the ear play in transmitting vibrations that enter the outer ear…

A: The ear is a vital organ that is responsible for both hearing and maintaining body balance. The…

Q: The main products of the light dependent reactions are: O water and carbon dioxide ATP and NADPH O…

A: To determine: To determine the main products of the light dependent reactions

Q: This type of fertilization happens when the sperm is introduced inside the female body through…

A: The process of fusion of sperm with egg (ovum) to produce zygote is called fertilization.

Q: B. Describe the following common patterns of inheritance in humans and give two human disorders for…

A: Understanding disease transmission patterns requires an understanding of basic inheritance laws.…

Q: Draw a simple diagram illustrating alternation of generations in plants, including the sporophyte…

A: The alternation of a sexual phase (n) and an asexual phase (2n) in the life cycle of an organism.…

Q: Are humans a land-sharer Or land-sparer? Why?

A: Land-sharing systems and Land-sparing systems are two contrasting approaches to sustainable living.

Q: In transcription, what is/are the importance of the series of nucleotide bases before the coding…

A: The coding region before transcription flanked by promoter sequence on 5' end on the template strand…

Q: ch of the following is NOT a feature associated with bipedalism? e legs are longer than the arms. e…

A: Before the evolution of bipedalism individual walked on the four legs this was called…

Q: What are the unifying characteristics of Gnathifera? Are these characteristics present in all…

A: Ahlrichs established the taxon Gnathifera based on morphological data. The Gnathostomulida and…

Q: PART OF THE SOLAR SPECTRUM PROVIDING BACTERICIDAL ACTION 1. visible light 2. infrared rays 3.…

A:

Q: How does Red Queen Hypothesis cause an evolutionary race with coronaviruses and mammalian species

A: RED QUEEN HYPOTHESIS - The Red Queen hypothesis was coined in evolutionary biology to explain that a…

Q: P. D, and Q are three genes found on a single chromosome in greyhounds. The recombination…

A: The genetic map is defined as the arrangements of genes according to the recombination frequencies…

Q: In photosynthesis which percentage of oxygen produced is used for cellular respiration in the plant?…

A: The oxygen that is released in the photosynthesis is used in the cellular respiration by the plants.…

Q: In the adaptive immune response which antigen are mount cellular responses? T helper lymphocytes T…

A: Answer

Q: The calculated chi-square value which is 0 is less than the critical value which is 5.991 (under the…

A: Given values calculated chi-square value= 0 critical value = 5.991  degree of freedom = 2

Q: The gram negative unknown organism that is Enterobacter aerogenes? What kind of the shape of…

A: Enterobacter aerogenes is a proteobacteria which belongs to Enterobacteriales and family…

Q: A compact disc (CD) stores about 4.8 × 109 bits of information in a 96 cm2 area. This information is…

A: The total set of nucleic acid sequences encoded as DNA within the 23 chromosomes is known as the…

Q: 3 8 2. 5. 1. 6. 7,

A: A cell is the basic unit of life. All living creatures are made up of cells, ranging from…

Q: Compare the auto induction media (AIM) with regular induced protein expression. Which is better when…

A: Most of the eukaryotic proteins are still produced via genetic engineering it into host prokaryotic…

Q: Matching Match each lettered term with the most closely related description. 12 a. induces ovulation…

A: Hormones are chemical messengers, produced and secreted directly into the circulation by endocrine…

Q: For the number 7.31000 Convert the number to Scientific Notation. If you add1 to the last position…

A: Given number is 7.31000 To do= add 1 in the last position and convert it into scientific notation.

Q: Why are bacteria and archaea classified into different domains

A: Archaea and bacteria are prokaryotic organisms but are placed in the different domains because they…

Q: SOURCE OF CARBON OXIDE IN AIR OF PREMISES IS 1. transportation 2. street dust 3. human breathing 4.…

A: Introduction The process of moving air into and out of the lungs to allow gas exchange with the…

Q: Can these two concepts apply to the relationship between polar bears and humans & if so, how ? : 1)…

A: An organism's "niche" is defined by the collection of circumstances, supplies, and relationships…

Q: The image above represents a simple cladogram for the primate order, where the letters are nodes and…

A:

Q: Distinguished between open and closed circulatory system, and discuss their effectiveness in…

A: All multicellular animals need a circulatory framework to transport oxygen and supplements through…

Q: Once pioneer transcription factors bind and attract chromatin remodelers, what do these chromatin…

A: The pioneer transcription factors are activators, they can associate with condensed chromatin. It…

Q: The two strands of a DNA double helix can be separated by heating. if you raised the temperature of…

A: In the DNA strands, between every A-T base-pairing there are two hydrogen bonds present while In…

Q: Many modern people have some Neanderthal DNAin their genome, but the Neanderthal alleles are…

A: In the last 100,000 years, Neanderthals and contemporary humans have interbred at least twice. It is…

Q: Portal System 1. What visceral organ system uses the portal system extensively?

A: Portal system in the body can be defined as a system in which blood present in one set of…

Q: savanna biomes

A: Biomes are defined by their unique vegetation and animal life.

Q: To examine: whether the statement "protein tyrosine phosphatases display exquisite specificity for…

A: Protein phosphatases are the enzymes which are involved in controlling diverse array of processes in…

Q: When you dig up a plant to move it from one spot toanother, the plant is more likely to survive if…

A: Plants are a big part of our lives. We see them every day, and they play a vital role in our…

Q: Criteria Replication Transcription Translation Template used Direction of synthesis Protein/enzyme…

A: Central dogma The replication, transcription and translation are collectively called central dogma.…

Q: SAMPLES THE DEVICE 1. rheometer 2. catatermeter 3. anemometer 4. Krotov's apparatus 5. luximeter

A: INTRODUCTION The indoor environment is extremely complicated. Both outdoor and indoor air contains…

Q: FILTERING IS FILTERING 1. physical method of disinfection 2. the physical method of water…

A: Q. FILTERING IS FILTERING   1. physical method of disinfection 2. the physical method of water…

Q: INDICATOR FOR EVALUATION OF EFFICIENCY OF WORK OF VENTILATION OF PREMISES OF RESIDENTIAL AND PUBLIC…

A: Answer is.. the content of harmful substances in the air.

Q: The process of respiration can be divided in several steps. Which of the following is the first one?…

A: Respiration is a process by which gas exchange take place between air and organism's cells. The…

Q: DISCUSS PROCEDURES AND METHODS  LABORATORY PROCEDURES PROCEDURES AND METHODS  Doudenal material…

A: Introduction A complete blood count (CBC) is the most common blood test performed. The CBC is a test…

Q: Show a cross for a sickle cell inheritance of a woman who is homozygous for the disease and a man…

A: Note: According to bartleby guidelines only first question is to be answered. So please upload other…

Q: what is structural gene and what is non-structural gene? what is the differences between them?

A: Introduction Genetics is the branch of science that deals with genetic material like genome, genes,…

Q: GENERAL EXCHANGE VENTILATION (MORE AIR ENTERS THAN IS REMOVED) IS NEEDED FOR GENERAL EXCHANGE OF…

A: Exaust Ventilation is used for  4). Preventing propagation of pollutants throughout the room.

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.