Q: The cell wall is made of cellulose phospholipids proteins starch
A: A subfield of biology called cell biology examines the composition, operation, and behavior of…
Q: Which of the following is true? a. A dominant allele is more common than a recessive allele b.…
A: The correct option will be : If both dominant and recessive alleles are present, the dominant…
Q: Match description with Term: 1) determine the amount of protein in a sample 2) determine the…
A: Recombinant DNA technology is a method by which several different genes can be combined from two…
Q: Which characteristics would you expect to be indicative of horizontal gene transfer? T / F A…
A: Genetic material between different bacterial species or cells can be done via Horizontal gene…
Q: Please define/describe the following 3 renal functions in mammals: filtration, reabsorption and…
A: Excretion The process of removal of waste products out of the body.
Q: Movement of molecules taken in from one site in the plasma membrane to a different region of the…
A: The movement of molecules taken in from one site in the plasma membrane to a different region of the…
Q: B D F A с E Shape Flagella Staphylococc Bacillus Staphylococci Bacillus Diplobacillus Gram stain…
A: Introduction R. H. Whittaker’s classification system divides organisms into five major groups. These…
Q: Visit www.mayoclinic.org to learn more about the gallbladder's role in fat breakdown. What dietary…
A: The dietary suggestions following gallbladder removal. 1. For at least a week following surgery,…
Q: Draw the two dipeptides formed from each pair of amino acids. a. tyrosine and lysine b. threonine…
A: Amino acids are the structural unit of proteins. Amino acids (same or different) join with one…
Q: Research and list down 10 different general and professional subjects of Medical Technology…
A: Medical technology includes the medical and surgical procedures, drugs, various equipments and…
Q: Charge from depolarization along the axon reaches the axon terminal, but there is a lack of…
A: Neurotransmitters can be defined as a chemical molecules that are involved in the transmission of…
Q: hunter fisher gatherers: Explain the methods of food production by these peoples/societies
A: The phrase "hunter-gatherers-fishers" is now frequently used to describe people who rely heavily on…
Q: Identify (determine the muscle naming term defined in each item) 1: Associated with the frontal bone…
A: A muscle is made up of several different muscular tissues that contract together to create force.…
Q: Fat soluble substance diffuse through the following regions of the selectively permeable cell…
A:
Q: The following describes the concentration of particles in a heavily salted solution: O a Hypertonic…
A: Osmolarity is a process of measurement of solute concentration. It is the number of osmoles (Osm) of…
Q: What is the typical composition of Harris Hematoxylin Solution? Which cellular organelle was more…
A: Typically employed at the microscopic level, staining is a method for enhancing contrast in…
Q: What is the difference among the true ribs, false ribs, and floating ribs? (Why are they labeled…
A: Introduction :- The bony skeleton, or rib cage, of the chest is made up of many pairs of narrow,…
Q: Describe 2 factors that contribute to the efficiency of gas exchange in fish gills. Why are fish…
A: Respiration The process of breathing in oxygen and breathing out carbon dioxide is known as…
Q: Where did the olive tree originally come from and where can we find it now?
A: Olive trees exhibit a clear predilection for calcareous soils, thriving best in coastal climates and…
Q: Why are individuals with an extra chromosome 21, that causes Down syndrome, more numerous than…
A: Extra Copy of chromosome cause different effects depend upon chromosome number . Some of the extra…
Q: Upon observation of the nutrient agar slant culture, you strongly suspect that the culture is…
A: Microbes are microscopic organisms that cannot be seen as such through naked eyes. Special…
Q: 26-29. Four of the nitrogenous bases that constitute part of a DNA or RNA molecule are (NO…
A: The most significant biological macromolecule is called nucleic acid, which consists of nitrogenous…
Q: Xanthoproteic test is used to detect amino acids containing an aromatic nucleus in a protein…
A: Introduction Organic substances known as amino acids have both functional groups for amino and…
Q: is involved in anterograde transport of proteins from the ER to Golgi. Ocaveolin clathrin COP II…
A: The vesicle transportation across cell is mediated by the microtubules present in the cell. The…
Q: What is the Posner task? Describe its purpose and setup (materials, conditions, etc.). What do its…
A: Posner task Michael Posner postulated this task. It refers to the neuropsychological test frequently…
Q: Pictured is one of the life stages of an Aurelia sp., or Moon Jellyfish, a Scyphozoan. Which life…
A: Introduction cnidarian, also called coelenterate, is a phylum under the kingdom Animalia containing…
Q: Would water molecules move faster when there is a high concentartion gradient or low concentartion…
A: Introduction The net movement of anything, typically from a place of higher concentration to a…
Q: Discuss the metabolic changes that take place in aspirin. How can it cause methemoglobenemia?
A: Introduction :- Aspirin belongs to a class of drugs known as salicylates. It functions by preventing…
Q: A population consists of 300 individuals with the following genotypes: AA – 100…
A: Since p = 1 - q and q is known, it is possible to calculate p as well. Knowing p and q, it is a…
Q: True or False: (T/F) Physical forces acting on the thorax and wing hinge during flight are detected…
A: Insects have flight muscles attached directly to their wings. Flight muscles move the wings…
Q: 3. Did your predictions match your results? 4. What may have occurred to cause the difference…
A: Question 3 and 4: Did your Prediction match your results? What may occurred to cause the difference?…
Q: What is B cell selection?
A: B Cell Selection: B Cells are the immunogenic cells, which are a type of lymphocytes or white blood…
Q: Give 4 exercise with the he of anatomical terms in describing the position and positive effect of…
A: Physical exercise is a subpart of physical activity that is intended, structured, and redundant,…
Q: Is a clean counter bacteria free?
A: Life includes germs on a regular basis. While some of them are beneficial, others are detrimental…
Q: 8. You have sequenced a segment of DNA from a species in the genus Lithobates (true frogs). The…
A: Template strand is a sense strand. and the coding stand which actually does not codes for m RNA is…
Q: QUESTION 17 How many peptide bonds in the structure below? 357 00 3 07 CH₂ white 8 9 QUESTION 18 How…
A: Proteins are a class of complex nitrogenous organic compounds composed of amino acid residuous join…
Q: hidden message of the cide: 5' - UGAUGAUGAUGAUGCAUGCUAACGAUUCCGCAAUGUCGAUAUCAAUACGUUGACC-3'
A: The structure and function of the entire body are controlled by DNA. It is present in every cell. It…
Q: If a human gene is found to contain five introns, the mature mRNA encoded by that gene would have…
A: Introduction The parts of a gene that are translated into proteins are called exons. Introns are…
Q: What are the advnatages of slide culture technique over wet mount technique for studying molds?…
A: Wet mount technique : this is the traditional method of preparing a slide to visualise a…
Q: 8. The membranes (envelopes) that coat some viruses consist of
A: Introduction A virus is an infectious submicroscopic creature that only reproduces inside of live…
Q: fermentation catabolic or anabolic
A: Introduction: In an anaerobic environment, enzymes are used in the chemical process of fermentation…
Q: 2. Pine pollen, 400X What are the key characteristics shared by all gymnosperms? Naked seeds 4. ● 3.…
A: According to our guideline we can answer only the first three subparts of the question. So, please…
Q: Il In the accompanying figure, determine the possible genotype(s) of IV-8. IV 1 2 3 OMA or Aa OAA…
A: Correct option is C. Above case is autosomal recessive disorder .. recessive is because generation…
Q: If you worked for a pharmaceutical company and wanted to develop a vaccine to prevent viral…
A: Through TQM, both upper-level management and front-line workers are incentivized to focus on the…
Q: How is the template strand the one being transcribed but the coding strand is the one that has the…
A: Introduction Because it serves as a template for transcription, the DNA strand from which mRNA is…
Q: What is the name of the organism most likely causing the diesease Syphillis? Streptococcus pyogenes…
A: Syphilis is a sexually transmitted infection (STI) that is usually defined as the way they are…
Q: How might humans interact with the system of insect infestation in tomatos in order to produce…
A: Introduction Like animals’ plants are also affected by various pathogenic species such as…
Q: Gluconeogenesis cannot use as a substrate. O Pyruvate O Alanine O Glutamate Palmitate
A: Glucose is an important carbohydrate molecule that is central to energy consumption. This glucose is…
Q: Which of the following is a synapomorphy of the Anthozoa? Exoskeletons of calcium carbonate O Corals…
A: Cnidaria is a diverse collection of creatures that live primarily in the sea. Because they rely on…
Q: Dizygotic twins are no more or less genetically similar than are other pairs of ________________.
A: Twins are named so because some of their completely identical features but there are certain…
Determine the titer for a plate made using milk and labeled 10^-6. you count 50 colonies. show your work
Step by step
Solved in 2 steps
- 1mL Stock #1 1mL 9mL #2 9mL #3 1mL A 9mL #4 0.1mL 1mL O O B 9mL #5 1mL 1mL 9mL #6 O Using the picture serial dilution scheme and the following information (plate A has 276 colonies, plate B has 298, plate C has 2, and plate D has 30), calculate the average number of colony forming units per mL in the stock tube. Make sure to only use countable plates. Round your answer to the nearest one. Write only the number with any needed commas or decimals. Do not include units. 0.1mL 1mk D OPlease note that these counts have all been done with Trypan Blue. Therefore, all cultures have been diluted two-fold (equal volume of cell suspension + equal volume of Trypan Blue). Take this into account when determining cell number. Any dilution listed in table is an additional dilution. Live and dead cells listed below represent the total number of cells in 5 large counting squares. *1 x 105 cells/ml cells were seeded into each well of the 24 well plate(s) on day 0 to begin the growth study. Plot this value at the zero time point on your graph.1These numbers represent the total number of cells counted in 5 large squares from three separate counts.Calculate the concentration of bacteriophage in the original culture from the following data. Be sure to include units. Show dilution factors for each test tube. Show the final dilution factor for test tube number 4. Show all your math. 0.1 ml 0.01 ml 0.001 ml 0.1 ml 1.0 ml plated 9.9 ml 9.99 ml 9.999 mi 9.9 m plaques Original Culture Test Test Test Test Tube #1 Tube #2 Tube #3 Tube #4 Dilution Factor: Concentration of Phage:
- You need to prepare medium for your culture cells. Your salt solution is supplied at a 10X concentration but needs to be 2X for use. You also need to add fetal bovine serum for a final concentration of 8%. What would you add of each for the correct final concentrations in 5 L of media?one lm of milk was added to 9 ml of sterile saline. 0.1ml of the diluted sample was put into a petri dish with melted agar. How many cfu/ml are in the milk if 200 colonies were counted?Ten grams of hamburger were added to 90 mL of sterile buffer. This was mixed well in a blender. One-tenth of amL of this slurry was added to 9.9 mL of sterile buffer. After thorough mixing, this suspension was further dilutedby successive 1/100 and 1/10 dilutions. One-tenth of a mL of this final solution was plated onto Plate Count agar.After incubation 145 colonies were present. How many colony-forming units were present in the total 10 gramsample of hamburger?
- Design a serial dilution of a 25-gram cheese sample to achieve a final dilution of 10-5 using 90 ml blanks. Show how you would plate out 10-2 through to 10-6Five grams of soil were added to 45 ml of sterile water and shaken vigorously. After that, 0.1 ml of this was added to 9.9 ml of sterile water. This was further diluted by four successive 1/10 dilutions. The last dilution was used to prepare a spread plate. After incubation, 58 colonies were present on this plate. What is the CFU/g of the soil sample? Assume: 1 g = 1 mLA urine sample is diluted 1:1,000. If 0.1 ml were put into a Petri dish with melted agar, how many CFU/ml are in the urine if 158 colonies grow?
- By alkaloidal reagent Place 3mL of egg albumin solution in each of the two test tubes, to one tube add 1 – 2 ml of tannic acid solution and to other one picric acid. Describe the appearance of the protein solutions in each of the tubes after addition of the alkaloidal reagents.Three grams of soil from the ground were added to 27 mL of sterile water and shaken vigorously. After the soil particles settled, 0.1 mL of this was added to 9.9 mL of sterile water. This was further diluted by 4 successive 1/10 dilutions. One mL from the last dilution was used to prepare a pour plate. After incubation, 289 colonies were present on this plate. What was the number of colony-forming units/gram of the soil?Below is a diagram of the serial dilution of a culture with 1 x 10º cells. Fill out the missing information. 250 Culture Diluent 1 x 10° cells/mL 9 mL 9 mL 9.9 mL 9.9 mL 99.9 mL Volume to add to diluent Final Dilution level Theoretical count after plating 100 uL