Q: Photosynthesis is the most important producer of molecular oxygen (02) on our planet. From which…
A: Introduction - Photosynthesis is the means used by plants and other organisms to convert light…
Q: How do antibodies work to eradicate pathogens?
A: Antibodies can be referred to as specialized Y-shaped proteins which have the ability to degrade the…
Q: What is the purpose of the "sodium/potassium pump" A. to perform endocytosis. B. to move sodium and…
A: Sodium/potassium pump: The sodium/potassium pump is referred as an enzyme that is found in the…
Q: Define and describe the stressors that may induce Artemia cysts to a state of dormancy How does the…
A: Introduction Artemia, popularly known as brine shrimp, is a genus of aquatic crustaceans. Artemia is…
Q: Explain how each of the following is a signaling molecule, an effector molecule or an adaptor…
A: Introduction :- Ligands, a broad name for compounds that bind selectively to other molecules, are…
Q: You work for a large biotechnology company that is studying viruses, vaccines, and small molecule…
A: There are few important points that should be kept in mind : Viruses are simple ,noncellular and…
Q: During which process of photosynthesis is water split and oxygen released? Calvin Cycle photosystem…
A: Photosynthesis is the process of conversion of CO2 and water molecule in sugars and oxygen.
Q: Which of the following groups of early-diverging animals is comprised of two layers of cells that…
A: Introduction Divergent evolution:- It refers to the process by which interbreeding species diverged…
Q: || II IV ve is a pedigree for longer teeth. trait autosomal dominant or autosomal recessive? Explain…
A: Pedigree analysis helps us identifying the mode of inheritance of a particular disease by observing…
Q: Describe the two organ systems of a flowering plant.
A: Introduction Organ systems are groups of organs that work together to perform a certain task for the…
Q: List down several concepts that the society or human being benefit from biodiversity.
A: Biodiversity is the different types of life forms that we see around us. It includes species as well…
Q: Leech obtains continuous blood flow from its victim by pouring in it-
A: Leeches Leeches are triploblastic coelomates belonging to the phylum Annelida. Their bodies are…
Q: The profile includes 4 STR loci. (D8S1179, D21S11, D7S820, CSF1PO) At how many of these is the…
A: Short Tandem Repeat Analysis STR analysis is a molecular technique by which short tandem repeats…
Q: Since different species of penguins may occupy the same habitat, explain why they may continue to…
A: Introduction Species include the members who are similar in morphology, and physiology and can…
Q: List and explain pre-analytical errors that can occur with a specimen and how these errors can…
A: Pre-analytical stages occur during patient preparation, sample collection, sample transportation,…
Q: The habit of a perennial plant's dropping its leaves, which have all died, at the end of the growing…
A: The answer is d. Deciduous
Q: 32) An origin of replication is given below. Sequences of selected parental strand regions are…
A: Introduction The process by which the genome's DNA is copied in cells is known as DNA replication.…
Q: 14. Why is titin important with respect to muscle contraction?
A: Titin is a striated muscle protein that is abundant. Titin's main duties are to stabilise the thick…
Q: In gram staining, could colors other than red be used as a counterstain?
A: A counterstain is a stain with color contrasting to the principle stain, making the stained…
Q: 1. After completing a life table for a population of beaver, you determine that the Net Reproductive…
A: A population is a changing entity and population growth refers to the change in the number of…
Q: What are the complections Of tooth extraction?
A: Introduction The removal of a tooth is known as tooth extraction. "An ideal tooth extraction is…
Q: You are counting white blood cells in a freshly drawn blood sample. You dilute the blood 1/20 in 5%…
A:
Q: 5. What is the correct reading frame for the following mRNA? MRNA 5' GGCACUUAUGCGAUGCCUUGAGUGACCAU…
A: mRNA is made from DNA by the process of Transcription.
Q: Stream invertebrates that break large pieces of allochthonous DOM into smaller pieces are referred…
A: Introduction Organic matter:- It is anything that contains carbon compounds that were formed by…
Q: what would happen if the blue crabs population increased substantially/
A: The sapphire-colored claws of the blue crab give it its name. In mature females, the shell, or…
Q: Ô https://blackboard.grandview.e.. A 自 D Question Completion Status: 2 points Save Answer QUESTION 5…
A: Fatty acids, that can not be synthesized by our body but they are essential for our good health.…
Q: 2. 3. What does the term symbiosis mean?
A: Introduction Ecology:- It is the study of the relationships between living organisms, including…
Q: of В C
A:
Q: sphingolipids
A: Plasmogens: The plasmogen is the chemical substance which is the important living portion of…
Q: Template strand/Sense strand Coding strand/Antisense strand Region of DNA unwinding Region of DNA…
A: The sense strand, or template strand, is the only strand that is effectively employed as a template…
Q: Mitochondria produce which of the following? A. ATP B. DNA C. RNA D. proteins
A: Answer :- Option A correct, Mitochondria which is produce ATP (adenosine tri phosphate) ATP are…
Q: Select the option that is a scientific hypothesis and is testable and false able?(Choose all that…
A: As per our company guideline we are supposed to answer only first question. Kindly repost other…
Q: Which are true about tick-borne bacterial diseases? Select which true O One example is the West Nile…
A: Examples for tick borne bacterial diseases include Lyme disease, Rocky Mountain Spotted Fever,etc.…
Q: Order Ca2+, CO2, ethanol, glucose, RNA, and H2Oaccording to their ability to diffuse through a lipid…
A: The lipid bilayer is composed of biological membranes and is composed of two layers of…
Q: Which statements are true? Explain why or why not.1 Because the DNA double helix is only 2 nm…
A: A gene is the essential physical and functional unit of heredity. Genes are comprised of DNA. A…
Q: Describe the timeline of an acute infection, particularly naming which cells are the first to arrive…
A: Acute infections are infections that are caused suddenly by any condition or by pathogens such as…
Q: A 43-year-old man is diagnosed with chronic myeloid leukemia (CML) and started on standard imatinib…
A: Man with Chronic myeloid leukemia treated with imatinib therapy :-
Q: 15. Why is PK > PNa and by about how much?
A: Significantly more potassium channels are open than sodium channels and this makes the membrane at…
Q: To determine: The re
A: Stomata- These are the minute pores surrounded by a pair of guard cell. These are also know as…
Q: write a short reflection paragraph on the role of extracellular matrix on tumor progression.
A: Cancer results from the formation of tumors that have the ability to metastasize.
Q: Match the letters with the enzyymes and macromolecules invoived DNA replication: A B INCOMING…
A: There are number of processes necessary for the continuation of generation , growth and…
Q: Describe the the levels of chromatic packing in an interphase nucleus.
A: Introduction Chromatin is a DNA-protein complex found in eukaryotic cells. The principal role is to…
Q: Question 88 How is a child with Type I diabetes similar to a child who is starving? Mark all that…
A:
Q: A previously healthy female patient presents with fatigue and insomnia. An examination shows she is…
A: Going by the description, the female is most likely suffering from Iron Deficiency Anemia.Iron…
Q: Categorize the fruit cantaloupe (Cucumis melo).
A: The ovary is fertilised in order to produce fruits with one or more seeds. The fruits' primary…
Q: Select the correct options in the following and explain your choices. if [s] is much smaller than…
A: Introduction :- Enzymes are proteins that enable our bodies' metabolism, or chemical reactions, go…
Q: A 32-year-old woman who are suffering from thyrotoxicosis a biopsy of the thyroid gland has shown…
A: Introduction :- Hassall's corpuscles are composed of a structureless eosinophilic mass surrounded by…
Q: A 43 year-old man is diagnosed with chronic myeloid leukemia (CML) and started on standard imatinib…
A: option d is the correct answer.
Q: An allosteric activator or inhibitor O a. Competes with substrate for enzyme binding O b. Shifts the…
A: Enzymes are the biological catalyst which increases the rate of reaction. The molecules upon which…
Q: Where is dentin matrix phosphoprotein expressed?
A: Dentin is mostly made up of hydroxyapatite crystals that are suspended in an organic matrix. This…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- As the text noted, two-thirds of the water and solutes that the body reclaims by reabsorption in nephrons occurs in the proximal tubule. Proximal tubule cells have large numbers of mitochondria and demand a great deal of oxygen. Explain why.Reabsorption depends on _________. a. osmosis across the nephron wall b. active transport of sodium across the nephron wall c. a steep solute concentration gradient d. all of the aboveThe filtrated fluid which is has passed through the proximal tubule and is about to enter the loop of Henle is filtrate which first entered the tubule. to the hyperosmotic hypoosmotic isoosmotic
- Which of the followings is correct about chloride reabsorption from the loop of Henle? Cl – is reabsorbed through the chloride channels of cells of the thick segment of loop of Henle Cl – is reabsorbed through paracellular gaps of the thick segment of loop of Henle Cl– is reabsorbed through Na–K–2Cl cotransporter in the basolateral membrane of the thick segment of loop of Henle All of the above is are correct None of the above is correctDescribe the characteristics of the two limbs of the loop of Henle with regard to their transport of Na1, Cl2, and water.In the presence of anti-diuretic hormone (ADH), which of the following does NOT occur? OAquaporins will be present ONLY in the apical membrane of the collecting duct ADH will bind to an ADH receptor, which is a metabotropic receptor O Adenylate cyclase will be activated, producing CAMP OWater flows down its concentration gradient, from high to low solute concentrations OAll of the above would occur
- Which of the following statements concerning the medullary verticle osmotic gradient is TRUE: W. The loops of Henle of juxtamedullary nephrons establish a medullary osmotic gradient by means of countercurrent multiplicationX. The vasa recta enable the medulla to be supplied with blood while conserving the medullary osmotic gradient Y. The medullary osmotic gradient permits excretion of urine of differing concentrationsZ. The collecting tubules of all nephrons descend through the medullary osmotic gradient before emptying into the renal pelvis Select one: a. if only W, X and Y are correct b. if only W and Y are correct c. if only X and Z are correct d. if only Z is correct e. if all are correctOne model of the glomerular membrane is a microporous membrane in which right cylindrical pores penetrate all the way through the membrane. Assume that the pores have a length of 50 nm and a radius of 3.5 nm. The viscosity of plasma is 0.002 Pa s. The average hydrostatic pressure in the glomerulus is 60 mm Hg, hydrostatic pressure in Bowman's space is 20 mm Hg and the average oncotic pressure of glomerular capillary blood is 28 mm Hg. A. Calculate the flow through a single pore assuming laminar flow (use the Poiseuille flow equation) B. How many pores would there have to be to produce a normal GFR? C. If the total aggregate area of the kidneys for filtration is 1.5 m2, what is the density of the pores (number of pores per unit area)? D. What fraction of the area is present as pores?Renal tubules cannot reabsorb HCO3–; yet HCO3–concentration in the tubular fluid falls while in the blood plasma itrises. Explain this apparent contradiction.
- Na+ ions are actively transported out of the tubules to help set up the countercurrent multiplier. Which of the following are sites of active Na+ ion transport in the nephron?Why is this statement false? Without the renal medullar osmotic gradient, you would not be able to raise the concentration of urine above 1200 mOsmConsidering the distal convoluted tubule of the amphibiannephron, explain how changes in the permeability of the tubulewall to water affect the amount of pure, osmotically free waterexcreted in the urine. Define what is meant by pure, osmoticallyfree water.